Rmu_sc0006589.1_g000010

Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006589.1
Physical Location & Seq
Reverse (-)
35771 .. 36115
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006589.1_g000010.1.cds

Sequence Viewer

Length: 345 bp
atgaagggcattgtgatctcaatgtttcttgtgctaggcacggctcacctaatggtgcatcaaggggaggcagttgagtgcacccaagtgaacctgttgttggctccttgcattccctacttgactggcaaggctactgaacccacagaggagtgctgccgtggggtgagtgacatcaagacactcaccccgaccaccgaggacaggcaggaggcctgtggatgtgttaagacagcagctgctcacatcccaaatgttgatccagctgcagctgctgctctcccaaccgagtgtaaagtagacattggaattccgatctcaaagaacaccaactgtcaggagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

114

Amino Acids

12.02

Weight (kDa)

5.08

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 300
AclWI GGATC 1 cut(s) 254
AcsI RAATTY 1 cut(s) 309
AfiI CCNNNNNNNGG 2 cut(s) 100, 204
AjuI GAANNNNNNNTTGG 2 cut(s) 83, 115
AleI CACNNNNGTG 1 cut(s) 86
AluBI AGCT 3 cut(s) 239, 266, 272
AluI AGCT 3 cut(s) 239, 266, 272
Alw21I GWGCWC 1 cut(s) 83
Alw44I GTGCAC 1 cut(s) 79
AlwI GGATC 1 cut(s) 254
AlwNI CAGNNNCTG 2 cut(s) 239, 275
AoxI GGCC 1 cut(s) 213
ApaLI GTGCAC 1 cut(s) 79
ApeKI GCWGC 7 cut(s) 156, 236, 239, 266, 269, 272, 275
ApoI RAATTY 1 cut(s) 309
AsuHPI GGTGA 3 cut(s) 38, 178, 178
BaeGI GKGCMC 1 cut(s) 83
Bbv12I GWGCWC 1 cut(s) 83
BbvI GCAGC 7 cut(s) 143, 226, 248, 253, 259, 262, 281
BceAI ACGGC 2 cut(s) 57, 144
BfaI CTAG 1 cut(s) 35
BfmI CTRYAG 1 cut(s) 267
BisI GCNGC 7 cut(s) 157, 237, 240, 267, 270, 273, 276
BlsI GCNGC 7 cut(s) 158, 238, 241, 268, 271, 274, 277
BmiI GGNNCC 1 cut(s) 105
BmsI GCATC 1 cut(s) 67
BsaJI CCNNGG 2 cut(s) 160, 198
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 204
Bse1I ACTGG 1 cut(s) 130
BseDI CCNNGG 2 cut(s) 160, 198
BseGI GGATG 2 cut(s) 227, 246
BseLI CCNNNNNNNGG 2 cut(s) 100, 204
BseNI ACTGG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 164
BseSI GKGCMC 1 cut(s) 83
BseXI GCAGC 7 cut(s) 143, 226, 248, 253, 259, 262, 281
BshFI GGCC 1 cut(s) 215
BsiHKAI GWGCWC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 100, 204
BsmI GAATGC 1 cut(s) 111
BsnI GGCC 1 cut(s) 215
Bsp1286I GDGCHC 1 cut(s) 83
Bsp143I GATC 3 cut(s) 15, 259, 315
BspANI GGCC 1 cut(s) 215
BspLI GGNNCC 1 cut(s) 105
BspMAI CTGCAG 1 cut(s) 271
BspPI GGATC 1 cut(s) 254
BsrI ACTGG 1 cut(s) 130
BssECI CCNNGG 2 cut(s) 160, 198
BssMI GATC 3 cut(s) 15, 259, 315
Bst4CI ACNGT 1 cut(s) 335
BstAPI GCANNNNNTGC 1 cut(s) 275
BstDSI CCRYGG 1 cut(s) 160
BstF5I GGATG 2 cut(s) 227, 246
BstKTI GATC 3 cut(s) 18, 262, 318
BstMBI GATC 3 cut(s) 15, 259, 315
BstMWI GCNNNNNNNGC 2 cut(s) 272, 275
BstSFI CTRYAG 1 cut(s) 267
BstSLI GKGCMC 1 cut(s) 83
BstV1I GCAGC 7 cut(s) 143, 226, 248, 253, 259, 262, 281
BsuRI GGCC 1 cut(s) 215
BtgI CCRYGG 1 cut(s) 160
BtsCI GGATG 2 cut(s) 227, 246
CaiI CAGNNNCTG 2 cut(s) 239, 275
CviJI RGCY 7 cut(s) 44, 104, 134, 215, 239, 266, 272
CviKI_1 RGCY 7 cut(s) 44, 104, 134, 215, 239, 266, 272
DpnI GATC 3 cut(s) 17, 261, 317
DpnII GATC 3 cut(s) 15, 259, 315
Eco147I AGGCCT 1 cut(s) 215
EcoRI GAATTC 1 cut(s) 309
FblI GTMKAC 1 cut(s) 300
Fnu4HI GCNGC 7 cut(s) 157, 237, 240, 267, 270, 273, 276
FokI GGATG 2 cut(s) 233, 234
Fsp4HI GCNGC 7 cut(s) 157, 237, 240, 267, 270, 273, 276
FspBI CTAG 1 cut(s) 35
GluI GCNGC 7 cut(s) 157, 237, 240, 267, 270, 273, 276
HaeIII GGCC 1 cut(s) 215
HphI GGTGA 3 cut(s) 38, 178, 178
Hpy166II GTNNAC 3 cut(s) 81, 91, 301
Hpy188I TCNGA 1 cut(s) 315
Hpy188III TCNNGA 2 cut(s) 178, 338
Hpy8I GTNNAC 3 cut(s) 81, 91, 301
HpyCH4III ACNGT 1 cut(s) 335
HpyCH4V TGCA 4 cut(s) 58, 81, 111, 269
HpyF10VI GCNNNNNNNGC 2 cut(s) 272, 275
Kzo9I GATC 3 cut(s) 15, 259, 315
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 7 cut(s) 107, 111, 190, 194, 229, 276, 323
Lsp1109I GCAGC 7 cut(s) 143, 226, 248, 253, 259, 262, 281
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 35
MaeIII GTNAC 1 cut(s) 170
MalI GATC 3 cut(s) 17, 261, 317
MboI GATC 3 cut(s) 15, 259, 315
MhlI GDGCHC 1 cut(s) 83
MluCI AATT 1 cut(s) 309
MnlI CCTC 4 cut(s) 61, 142, 193, 205
MseI TTAA 1 cut(s) 228
MslI CAYNNNNRTG 1 cut(s) 86
MspA1I CMGCKG 3 cut(s) 239, 266, 272
Mva1269I GAATGC 1 cut(s) 111
MwoI GCNNNNNNNGC 2 cut(s) 272, 275
NdeII GATC 3 cut(s) 15, 259, 315
NlaIV GGNNCC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 170
OliI CACNNNNGTG 1 cut(s) 86
PceI AGGCCT 1 cut(s) 215
PctI GAATGC 1 cut(s) 111
PkrI GCNGC 7 cut(s) 158, 238, 241, 268, 271, 274, 277
PspN4I GGNNCC 1 cut(s) 105
PstI CTGCAG 1 cut(s) 271
PstNI CAGNNNCTG 2 cut(s) 239, 275
PvuII CAGCTG 3 cut(s) 239, 266, 272
RseI CAYNNNNRTG 1 cut(s) 86
SaqAI TTAA 1 cut(s) 228
SatI GCNGC 7 cut(s) 157, 237, 240, 267, 270, 273, 276
Sau3AI GATC 3 cut(s) 15, 259, 315
SduI GDGCHC 1 cut(s) 83
SetI ASST 5 cut(s) 51, 96, 241, 268, 274
SfaNI GCATC 1 cut(s) 67
SfcI CTRYAG 1 cut(s) 267
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 1 cut(s) 309
SseBI AGGCCT 1 cut(s) 215
SspMI CTAG 1 cut(s) 35
StuI AGGCCT 1 cut(s) 215
TaaI ACNGT 1 cut(s) 335
TasI AATT 1 cut(s) 309
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TseFI GTSAC 1 cut(s) 170
TseI GCWGC 7 cut(s) 156, 236, 239, 266, 269, 272, 275
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 1 cut(s) 17
VneI GTGCAC 1 cut(s) 79
XapI RAATTY 1 cut(s) 309
XmiI GTMKAC 1 cut(s) 300
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.