pycom07g10420

Myelodysplasia-myeloid leukemia factor 1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0005437
Physical Location & Seq
Forward (+)
10339665 .. 10340252
588 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g10420.2

Sequence Viewer

Length: 456 bp
ATGAAATCTATACTGGCATTTTCTGATTCCAGAGGGAAAAACACCACCAAAATGCAAAGTGAAAGAGACACTAGAGATGGTGTTTCTCGGTCACACGGATTGTTAGATAGTTTCCAGGGATTTGGGTCCAGAAGAAGCAAGATCCCTAGCCTTTTTGGTGGAAGGGATCCATTTGGTGATCCCTTCTTCAGTCGCCCGATTGGTAGCATCTTCGAGTCTAGTATGTTCGGTCCAAGTTCCGTTTCTAATGATACACCGGAGAGTGGTAGAGCCAACAAAATATCAGTTGAAGAATTGAACTCTGATGATGAGGGATGGCAAGATAAAGTTACTGGGGATGAAAGAGATAACATTGGAAAGCGATCAGTTTCAGGCAAAGAACCATCAATTGAGCATCCAGATGATGTTGTGGACCGTAGTGAAATTTCCACATCTTTGTTGCTTAAAAACTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko05202 map05202
Pfam Domains
Protein Families
Mlf1IP

Protein Analysis

152

Amino Acids

16.56

Weight (kDa)

5.24

Isoelectric Point (pI)

60.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 136, 161, 173, 174
AcsI RAATTY 1 cut(s) 423
AcuI CTGAAG 1 cut(s) 172
AfiI CCNNNNNNNGG 1 cut(s) 263
AgsI TTSAA 2 cut(s) 290, 298
AjnI CCWGG 1 cut(s) 114
AjuI GAANNNNNNNTTGG 2 cut(s) 226, 258
Alw26I GTCTC 1 cut(s) 60
AlwI GGATC 4 cut(s) 136, 161, 173, 174
ApoI RAATTY 1 cut(s) 423
AspS9I GGNCC 3 cut(s) 126, 230, 412
AsuHPI GGTGA 1 cut(s) 188
AvaII GGWCC 3 cut(s) 126, 230, 412
BamHI GGATCC 1 cut(s) 166
BccI CCATC 3 cut(s) 71, 309, 391
BciT130I CCWGG 1 cut(s) 116
BcoDI GTCTC 1 cut(s) 60
BfaI CTAG 3 cut(s) 72, 147, 219
Bme1390I CCNGG 1 cut(s) 116
Bme18I GGWCC 3 cut(s) 126, 230, 412
BmgT120I GGNCC 3 cut(s) 126, 230, 412
BmiI GGNNCC 2 cut(s) 127, 168
BmrFI CCNGG 1 cut(s) 116
BmrI ACTGGG 1 cut(s) 342
BmsI GCATC 2 cut(s) 216, 403
BmuI ACTGGG 1 cut(s) 342
BsaJI CCNNGG 1 cut(s) 115
BsaWI WCCGGW 1 cut(s) 256
Bsc4I CCNNNNNNNGG 1 cut(s) 263
Bse1I ACTGG 2 cut(s) 18, 337
BseBI CCWGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 115
BseGI GGATG 3 cut(s) 320, 343, 394
BseLI CCNNNNNNNGG 1 cut(s) 263
BseNI ACTGG 2 cut(s) 18, 337
BsiSI CCGG 1 cut(s) 257
BslI CCNNNNNNNGG 1 cut(s) 263
BsmAI GTCTC 1 cut(s) 60
Bsp143I GATC 4 cut(s) 141, 166, 178, 362
BspLI GGNNCC 2 cut(s) 127, 168
BspPI GGATC 4 cut(s) 136, 161, 173, 174
BsrI ACTGG 2 cut(s) 18, 337
BssECI CCNNGG 1 cut(s) 115
BssMI GATC 4 cut(s) 141, 166, 178, 362
Bst2UI CCWGG 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 416, 452
BstF5I GGATG 3 cut(s) 320, 343, 394
BstKTI GATC 4 cut(s) 144, 169, 181, 365
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 4 cut(s) 141, 166, 178, 362
BstNI CCWGG 1 cut(s) 116
BstSCI CCNGG 1 cut(s) 114
BstX2I RGATCY 2 cut(s) 141, 166
BstXI CCANNNNNNTGG 1 cut(s) 122
BstYI RGATCY 2 cut(s) 141, 166
BtsCI GGATG 3 cut(s) 320, 343, 394
Cfr13I GGNCC 3 cut(s) 126, 230, 412
CviJI RGCY 2 cut(s) 150, 272
CviKI_1 RGCY 2 cut(s) 150, 272
DpnI GATC 4 cut(s) 143, 168, 180, 364
DpnII GATC 4 cut(s) 141, 166, 178, 362
Eco47I GGWCC 3 cut(s) 126, 230, 412
Eco57I CTGAAG 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 114
FaiI YATR 2 cut(s) 11, 224
FokI GGATG 3 cut(s) 327, 350, 381
FspBI CTAG 3 cut(s) 72, 147, 219
HapII CCGG 1 cut(s) 257
HinfI GANTC 2 cut(s) 26, 215
HpaII CCGG 1 cut(s) 257
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 1 cut(s) 412
Hpy188I TCNGA 2 cut(s) 25, 304
Hpy188III TCNNGA 3 cut(s) 30, 129, 398
Hpy8I GTNNAC 1 cut(s) 412
HpyAV CCTTC 2 cut(s) 156, 193
HpyCH4III ACNGT 2 cut(s) 416, 452
HpyCH4V TGCA 1 cut(s) 55
Kzo9I GATC 4 cut(s) 141, 166, 178, 362
LpnPI CCDG 8 cut(s) 43, 101, 128, 142, 270, 318, 357, 411
LweI GCATC 2 cut(s) 216, 403
MaeI CTAG 3 cut(s) 72, 147, 219
MaeIII GTNAC 2 cut(s) 90, 328
MalI GATC 4 cut(s) 143, 168, 180, 364
MboI GATC 4 cut(s) 141, 166, 178, 362
MboII GAAGA 4 cut(s) 144, 178, 202, 302
MfeI CAATTG 1 cut(s) 387
MflI RGATCY 2 cut(s) 141, 166
MluCI AATT 3 cut(s) 293, 387, 423
MlyI GAGTC 1 cut(s) 224
MnlI CCTC 2 cut(s) 26, 304
MseI TTAA 2 cut(s) 444, 454
MslI CAYNNNNRTG 2 cut(s) 50, 399
MspI CCGG 1 cut(s) 257
MspR9I CCNGG 1 cut(s) 116
MunI CAATTG 1 cut(s) 387
MvaI CCWGG 1 cut(s) 116
NdeII GATC 4 cut(s) 141, 166, 178, 362
NlaIV GGNNCC 2 cut(s) 127, 168
NmuCI GTSAC 1 cut(s) 90
PfeI GAWTC 1 cut(s) 26
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 114
PspGI CCWGG 1 cut(s) 114
PspN4I GGNNCC 2 cut(s) 127, 168
PspPI GGNCC 3 cut(s) 126, 230, 412
PsuI RGATCY 2 cut(s) 141, 166
RseI CAYNNNNRTG 2 cut(s) 50, 399
SaqAI TTAA 2 cut(s) 444, 454
Sau3AI GATC 4 cut(s) 141, 166, 178, 362
Sau96I GGNCC 3 cut(s) 126, 230, 412
SchI GAGTC 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 116
SfaNI GCATC 2 cut(s) 216, 403
SinI GGWCC 3 cut(s) 126, 230, 412
SmiMI CAYNNNNRTG 2 cut(s) 50, 399
Sse9I AATT 3 cut(s) 293, 387, 423
SspMI CTAG 3 cut(s) 72, 147, 219
StyD4I CCNGG 1 cut(s) 114
TaaI ACNGT 2 cut(s) 416, 452
TaqI TCGA 1 cut(s) 213
TaqII GACCGA 2 cut(s) 78, 218
TasI AATT 3 cut(s) 293, 387, 423
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 2 cut(s) 444, 454
Tru9I TTAA 2 cut(s) 444, 454
TseFI GTSAC 1 cut(s) 90
Tsp45I GTSAC 1 cut(s) 90
TspDTI ATGAA 2 cut(s) 17, 354
TspGWI ACGGA 2 cut(s) 111, 229
VpaK11BI GGWCC 3 cut(s) 126, 230, 412
XapI RAATTY 1 cut(s) 423
XspI CTAG 3 cut(s) 72, 147, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.