pycom08g15580

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
Physical Location & Seq
Reverse (-)
15340190 .. 15340456
267 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom08g15580.1

Sequence Viewer

Length: 267 bp
ATGGTTGTGTTGAATCTATTGATCGATATTCTTCGACGATGTGATCGTGCAAAGTTAGTGTGGAATCAATTGGGTATGCATTCAATTGTTCTGTCCTCGGTTGATATTGACTTTCATGATTGGATGAGAGTGAATCTTTTTTCGAGAAGTTTGCTTTGCCATAATCTGCCTTGGTGGGGTGTTTTTGCCTTTGCTTGTTGGTGGTTATGGAAATGGAGGAATTTAAGCATTTTTGCGTCTGATTTCATTTTCCCAAGTCAACCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

89

Amino Acids

10.59

Weight (kDa)

8.66

Isoelectric Point (pI)

64.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 220
AfiI CCNNNNNNNGG 1 cut(s) 176
AgsI TTSAA 2 cut(s) 13, 84
ApoI RAATTY 1 cut(s) 220
BcgI CGANNNNNNTGC 2 cut(s) 133, 167
Bsa29I ATCGAT 1 cut(s) 24
BsaJI CCNNGG 2 cut(s) 96, 170
Bsc4I CCNNNNNNNGG 1 cut(s) 176
BseCI ATCGAT 1 cut(s) 24
BseDI CCNNGG 2 cut(s) 96, 170
BseGI GGATG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 176
BshVI ATCGAT 1 cut(s) 24
BslI CCNNNNNNNGG 1 cut(s) 176
BsmI GAATGC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 21, 43
BspDI ATCGAT 1 cut(s) 24
BspHI TCATGA 1 cut(s) 115
BssECI CCNNGG 2 cut(s) 96, 170
BssMI GATC 2 cut(s) 21, 43
BssT1I CCWWGG 1 cut(s) 170
BstDEI CTNAG 1 cut(s) 264
BstF5I GGATG 1 cut(s) 129
BstKTI GATC 2 cut(s) 24, 46
BstMBI GATC 2 cut(s) 21, 43
Bsu15I ATCGAT 1 cut(s) 24
BsuTUI ATCGAT 1 cut(s) 24
BtsCI GGATG 1 cut(s) 129
CciI TCATGA 1 cut(s) 115
ClaI ATCGAT 1 cut(s) 24
CseI GACGC 1 cut(s) 225
CviAII CATG 1 cut(s) 116
DdeI CTNAG 1 cut(s) 264
DpnI GATC 2 cut(s) 23, 45
DpnII GATC 2 cut(s) 21, 43
Eco130I CCWWGG 1 cut(s) 170
EcoT14I CCWWGG 1 cut(s) 170
EcoT22I ATGCAT 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 1 cut(s) 119
FaiI YATR 4 cut(s) 77, 117, 162, 208
FalI AAGNNNNNCTT 1 cut(s) 247
FatI CATG 1 cut(s) 115
FokI GGATG 1 cut(s) 136
HgaI GACGC 1 cut(s) 225
Hin1II CATG 1 cut(s) 119
HincII GTYRAC 1 cut(s) 260
HindII GTYRAC 1 cut(s) 260
HinfI GANTC 3 cut(s) 13, 64, 133
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 2 cut(s) 116, 144
Hpy8I GTNNAC 1 cut(s) 260
Hpy99I CGWCG 1 cut(s) 39
HpyCH4V TGCA 2 cut(s) 50, 79
HpyF3I CTNAG 1 cut(s) 264
Hsp92II CATG 1 cut(s) 119
Kzo9I GATC 2 cut(s) 21, 43
MalI GATC 2 cut(s) 23, 45
MboI GATC 2 cut(s) 21, 43
MboII GAAGA 1 cut(s) 23
MfeI CAATTG 2 cut(s) 68, 84
MluCI AATT 3 cut(s) 68, 84, 220
MnlI CCTC 2 cut(s) 106, 210
Mph1103I ATGCAT 1 cut(s) 81
MseI TTAA 1 cut(s) 224
MunI CAATTG 2 cut(s) 68, 84
Mva1269I GAATGC 1 cut(s) 79
NdeII GATC 2 cut(s) 21, 43
NlaIII CATG 1 cut(s) 119
NsiI ATGCAT 1 cut(s) 81
PagI TCATGA 1 cut(s) 115
PcsI WCGNNNNNNNCGW 1 cut(s) 43
PctI GAATGC 1 cut(s) 79
PfeI GAWTC 3 cut(s) 13, 64, 133
SaqAI TTAA 1 cut(s) 224
Sau3AI GATC 2 cut(s) 21, 43
SetI ASST 1 cut(s) 265
SgeI CNNG 6 cut(s) 59, 109, 128, 156, 183, 207
Sse9I AATT 3 cut(s) 68, 84, 220
StyI CCWWGG 1 cut(s) 170
TaqI TCGA 3 cut(s) 24, 34, 143
TasI AATT 3 cut(s) 68, 84, 220
TfiI GAWTC 3 cut(s) 13, 64, 133
Tru1I TTAA 1 cut(s) 224
Tru9I TTAA 1 cut(s) 224
TspDTI ATGAA 2 cut(s) 104, 235
XapI RAATTY 1 cut(s) 220
Zsp2I ATGCAT 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.