Rmu_sc0010958.1_g000004

acid phosphatase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010958.1
OG0008916
Physical Location & Seq
Reverse (-)
8085 .. 8732
648 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010958.1_g000004.1.cds

Sequence Viewer

Length: 648 bp
atgcataagaaaaagagactccttgccagaattgggggaattcaaaaggcaagagacaggtttgataaccccttcctgattaatcttgaggctgatctcattcaagaatatgaaacgctcatagaccaagaaaacatgttctggagacaaaaatcaagagataagtggcttcaagatggtgacagaaacactaggtttttccatcttattactctggttagaaggagaagacataaaattgagggccttttttacagcaatggtaactgttttactgactctgattctatgaaaaagattgttgttgacttcttcactgatcttttctctcgacattgctctgatgatattagattcttaatcccatggttatttccttttattgatcagtcaagcttagatagcatctgcaggcctattactcttctggaagtcaatgactctctcttttcaattggtggacttaaggctcctggttttgatggctttcctgccatcttttatcagcatcattgccaaatatactcctgtgagattttcaaagttgttagcgatgctttcatgtctaacacaattcctcctggactcaaccacacaattatctctctcatccccaagattgatggaccacatcatatatatgactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

215

Amino Acids

25.2

Weight (kDa)

7.11

Isoelectric Point (pI)

53.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 33
AflII CTTAAG 1 cut(s) 464
AflIII ACRYGT 1 cut(s) 135
AgsI TTSAA 5 cut(s) 44, 104, 173, 453, 541
AjnI CCWGG 2 cut(s) 472, 580
AluBI AGCT 1 cut(s) 396
AluI AGCT 1 cut(s) 396
Alw26I GTCTC 3 cut(s) 10, 48, 139
AoxI GGCC 2 cut(s) 244, 413
ApoI RAATTY 1 cut(s) 39
AseI ATTAAT 1 cut(s) 81
AspS9I GGNCC 2 cut(s) 244, 626
AsuHPI GGTGA 1 cut(s) 191
AvaII GGWCC 1 cut(s) 626
BbsI GAAGAC 1 cut(s) 235
BccI CCATC 5 cut(s) 170, 210, 476, 503, 617
BciT130I CCWGG 2 cut(s) 474, 582
BclI TGATCA 1 cut(s) 385
BcoDI GTCTC 3 cut(s) 10, 48, 139
BfaI CTAG 1 cut(s) 192
BfmI CTRYAG 1 cut(s) 409
BfrI CTTAAG 1 cut(s) 464
Bme1390I CCNGG 2 cut(s) 474, 582
Bme18I GGWCC 1 cut(s) 626
BmgT120I GGNCC 2 cut(s) 244, 626
BmiI GGNNCC 1 cut(s) 471
BmrFI CCNGG 2 cut(s) 474, 582
BmsI GCATC 3 cut(s) 414, 517, 544
BpiI GAAGAC 1 cut(s) 235
BpmI CTGGAG 1 cut(s) 163
BpuEI CTTGAG 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 365
BsaXI ACNNNNNCTCC 2 cut(s) 562, 592
Bsc4I CCNNNNNNNGG 1 cut(s) 33
Bse3DI GCAATG 3 cut(s) 265, 334, 511
BseBI CCWGG 2 cut(s) 474, 582
BseDI CCNNGG 1 cut(s) 365
BseGI GGATG 1 cut(s) 609
BseLI CCNNNNNNNGG 1 cut(s) 33
BseMI GCAATG 3 cut(s) 265, 334, 511
BshFI GGCC 2 cut(s) 246, 415
BslI CCNNNNNNNGG 1 cut(s) 33
BsmAI GTCTC 3 cut(s) 10, 48, 139
BsnI GGCC 2 cut(s) 246, 415
Bsp143I GATC 3 cut(s) 94, 319, 385
Bsp19I CCATGG 1 cut(s) 365
BspANI GGCC 2 cut(s) 246, 415
BspLI GGNNCC 1 cut(s) 471
BspMAI CTGCAG 1 cut(s) 413
BspTI CTTAAG 1 cut(s) 464
BsrDI GCAATG 3 cut(s) 265, 334, 511
BssECI CCNNGG 1 cut(s) 365
BssMI GATC 3 cut(s) 94, 319, 385
BssT1I CCWWGG 1 cut(s) 365
Bst2UI CCWGG 2 cut(s) 474, 582
Bst4CI ACNGT 1 cut(s) 269
Bst6I CTCTTC 1 cut(s) 429
BstAFI CTTAAG 1 cut(s) 464
BstC8I GCNNGC 1 cut(s) 413
BstDEI CTNAG 1 cut(s) 397
BstDSI CCRYGG 1 cut(s) 365
BstF5I GGATG 1 cut(s) 609
BstKTI GATC 3 cut(s) 97, 322, 388
BstMAI GTCTC 3 cut(s) 10, 48, 139
BstMBI GATC 3 cut(s) 94, 319, 385
BstMWI GCNNNNNNNGC 1 cut(s) 402
BstNI CCWGG 2 cut(s) 474, 582
BstNSI RCATGY 1 cut(s) 139
BstSCI CCNGG 2 cut(s) 472, 580
BstSFI CTRYAG 1 cut(s) 409
BstV2I GAAGAC 1 cut(s) 235
BsuRI GGCC 2 cut(s) 246, 415
BtgI CCRYGG 1 cut(s) 365
BtgZI GCGATG 1 cut(s) 567
BtsCI GGATG 1 cut(s) 609
BtsIMutI CAGTG 1 cut(s) 315
Cac8I GCNNGC 1 cut(s) 413
Cfr13I GGNCC 2 cut(s) 244, 626
CviAII CATG 3 cut(s) 136, 366, 562
CviJI RGCY 7 cut(s) 92, 169, 246, 396, 415, 470, 486
CviKI_1 RGCY 7 cut(s) 92, 169, 246, 396, 415, 470, 486
DdeI CTNAG 1 cut(s) 397
DpnI GATC 3 cut(s) 96, 321, 387
DpnII GATC 3 cut(s) 94, 319, 385
Eam1104I CTCTTC 1 cut(s) 429
EarI CTCTTC 1 cut(s) 429
Eco130I CCWWGG 1 cut(s) 365
Eco147I AGGCCT 1 cut(s) 415
Eco47I GGWCC 1 cut(s) 626
EcoO109I RGGNCCY 1 cut(s) 244
EcoRI GAATTC 1 cut(s) 39
EcoRII CCWGG 2 cut(s) 472, 580
EcoT14I CCWWGG 1 cut(s) 365
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 365
FaeI CATG 3 cut(s) 139, 369, 565
FatI CATG 3 cut(s) 135, 365, 561
FbaI TGATCA 1 cut(s) 385
FokI GGATG 1 cut(s) 596
FspBI CTAG 1 cut(s) 192
GsuI CTGGAG 1 cut(s) 163
HaeIII GGCC 2 cut(s) 246, 415
Hin1II CATG 3 cut(s) 139, 369, 565
HincII GTYRAC 1 cut(s) 307
HindII GTYRAC 1 cut(s) 307
HindIII AAGCTT 1 cut(s) 394
HinfI GANTC 6 cut(s) 18, 278, 284, 354, 440, 585
HphI GGTGA 1 cut(s) 191
Hpy166II GTNNAC 2 cut(s) 307, 461
Hpy188I TCNGA 2 cut(s) 283, 343
Hpy188III TCNNGA 8 cut(s) 76, 86, 104, 142, 156, 173, 330, 428
Hpy8I GTNNAC 2 cut(s) 307, 461
HpyAV CCTTC 2 cut(s) 82, 216
HpyCH4III ACNGT 1 cut(s) 269
HpyCH4V TGCA 2 cut(s) 4, 411
HpyF10VI GCNNNNNNNGC 1 cut(s) 402
HpyF3I CTNAG 1 cut(s) 397
Hsp92II CATG 3 cut(s) 139, 369, 565
Ksp22I TGATCA 1 cut(s) 385
Kzo9I GATC 3 cut(s) 94, 319, 385
LmnI GCTCC 1 cut(s) 475
LweI GCATC 3 cut(s) 414, 517, 544
MaeI CTAG 1 cut(s) 192
MaeIII GTNAC 2 cut(s) 179, 263
MalI GATC 3 cut(s) 96, 321, 387
MboI GATC 3 cut(s) 94, 319, 385
MboII GAAGA 3 cut(s) 240, 304, 416
MfeI CAATTG 1 cut(s) 453
MluCI AATT 6 cut(s) 30, 39, 237, 453, 573, 597
MlyI GAGTC 4 cut(s) 12, 272, 434, 579
MnlI CCTC 3 cut(s) 82, 235, 588
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 3 cut(s) 81, 359, 465
MslI CAYNNNNRTG 1 cut(s) 639
MspCI CTTAAG 1 cut(s) 464
MspR9I CCNGG 2 cut(s) 474, 582
MunI CAATTG 1 cut(s) 453
MvaI CCWGG 2 cut(s) 474, 582
MwoI GCNNNNNNNGC 1 cut(s) 402
NcoI CCATGG 1 cut(s) 365
NdeII GATC 3 cut(s) 94, 319, 385
NlaIII CATG 3 cut(s) 139, 369, 565
NlaIV GGNNCC 1 cut(s) 471
NmuCI GTSAC 1 cut(s) 179
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 139
PceI AGGCCT 1 cut(s) 415
PciI ACATGT 1 cut(s) 135
PfeI GAWTC 2 cut(s) 284, 354
PfoI TCCNGGA 1 cut(s) 580
PleI GAGTC 4 cut(s) 12, 272, 434, 579
PpsI GAGTC 4 cut(s) 12, 272, 434, 579
PscI ACATGT 1 cut(s) 135
PshBI ATTAAT 1 cut(s) 81
Psp6I CCWGG 2 cut(s) 472, 580
PspGI CCWGG 2 cut(s) 472, 580
PspN4I GGNNCC 1 cut(s) 471
PspPI GGNCC 2 cut(s) 244, 626
PstI CTGCAG 1 cut(s) 413
RseI CAYNNNNRTG 1 cut(s) 639
SaqAI TTAA 3 cut(s) 81, 359, 465
Sau3AI GATC 3 cut(s) 94, 319, 385
Sau96I GGNCC 2 cut(s) 244, 626
SchI GAGTC 4 cut(s) 12, 272, 434, 579
ScrFI CCNGG 2 cut(s) 474, 582
SetI ASST 3 cut(s) 62, 197, 398
SfaNI GCATC 3 cut(s) 414, 517, 544
SfcI CTRYAG 1 cut(s) 409
SinI GGWCC 1 cut(s) 626
SmiMI CAYNNNNRTG 1 cut(s) 639
SmlI CTYRAG 2 cut(s) 86, 464
SmoI CTYRAG 2 cut(s) 86, 464
Sse9I AATT 6 cut(s) 30, 39, 237, 453, 573, 597
SseBI AGGCCT 1 cut(s) 415
SspMI CTAG 1 cut(s) 192
StuI AGGCCT 1 cut(s) 415
StyD4I CCNGG 2 cut(s) 472, 580
StyI CCWWGG 1 cut(s) 365
TaaI ACNGT 1 cut(s) 269
TaqI TCGA 1 cut(s) 331
TasI AATT 6 cut(s) 30, 39, 237, 453, 573, 597
TfiI GAWTC 2 cut(s) 284, 354
Tru1I TTAA 3 cut(s) 81, 359, 465
Tru9I TTAA 3 cut(s) 81, 359, 465
TscAI CASTG 1 cut(s) 322
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 3 cut(s) 126, 305, 550
TspRI CASTG 1 cut(s) 322
Vha464I CTTAAG 1 cut(s) 464
VpaK11BI GGWCC 1 cut(s) 626
VspI ATTAAT 1 cut(s) 81
XapI RAATTY 1 cut(s) 39
XceI RCATGY 1 cut(s) 139
XspI CTAG 1 cut(s) 192
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.