Rw5G037290

Ribonuclease H protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
65678244 .. 65678555
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G037290.1

Sequence Viewer

Length: 312 bp
ATGGATGCTCTGCAGCCTTTGAAGTCTATCAATTGTCACCCTTCCAAAGCTGTGAAATCAAGCAACAAGGTTGCTAATGTGTTGTTCAAAATTAGATCGGATTCTGAGATTGGAATGCACATGGTTATGCAGCCTCCTCCACAAGTTATTACTTTGCTGCTGGATGATTTATGTGAAACATCAAGTTTTAGGAGCAAATACCTAGTTTCTGATTTGTTTCCATGTTTTGTTGGGCATTTTGGCCCCCATTTAACCAAAAAATGTTACTCTAGTTGGATTGTAAAGCAATGTTCTGAACTACTTTATGTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.62

Weight (kDa)

8.64

Isoelectric Point (pI)

50.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 22, 88
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
AoxI GGCC 1 cut(s) 241
ApeKI GCWGC 3 cut(s) 13, 130, 157
AspS9I GGNCC 1 cut(s) 242
AsuHPI GGTGA 1 cut(s) 29
BbvI GCAGC 3 cut(s) 25, 142, 144
BfaI CTAG 2 cut(s) 203, 270
BfmI CTRYAG 1 cut(s) 11
BisI GCNGC 3 cut(s) 14, 131, 158
BlsI GCNGC 3 cut(s) 15, 132, 159
BmgT120I GGNCC 1 cut(s) 242
BmiI GGNNCC 1 cut(s) 244
Bse3DI GCAATG 1 cut(s) 293
BseGI GGATG 2 cut(s) 10, 169
BseMI GCAATG 1 cut(s) 293
BseMII CTCAG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 126
BseXI GCAGC 3 cut(s) 25, 142, 144
BshFI GGCC 1 cut(s) 243
BsmI GAATGC 1 cut(s) 120
BsnI GGCC 1 cut(s) 243
Bsp143I GATC 1 cut(s) 95
BspANI GGCC 1 cut(s) 243
BspCNI CTCAG 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 244
BspMAI CTGCAG 1 cut(s) 15
BsrDI GCAATG 1 cut(s) 293
BssMI GATC 1 cut(s) 95
BstDEI CTNAG 1 cut(s) 105
BstF5I GGATG 2 cut(s) 10, 169
BstKTI GATC 1 cut(s) 98
BstMBI GATC 1 cut(s) 95
BstSFI CTRYAG 1 cut(s) 11
BstV1I GCAGC 3 cut(s) 25, 142, 144
BsuRI GGCC 1 cut(s) 243
BtsCI GGATG 2 cut(s) 10, 169
Cfr13I GGNCC 1 cut(s) 242
CviAII CATG 2 cut(s) 121, 222
CviJI RGCY 4 cut(s) 16, 50, 133, 243
CviKI_1 RGCY 4 cut(s) 16, 50, 133, 243
DdeI CTNAG 1 cut(s) 105
DpnI GATC 1 cut(s) 97
DpnII GATC 1 cut(s) 95
FaeI CATG 2 cut(s) 124, 225
FaiI YATR 6 cut(s) 122, 128, 172, 223, 306, 310
FatI CATG 2 cut(s) 120, 221
Fnu4HI GCNGC 3 cut(s) 14, 131, 158
FokI GGATG 2 cut(s) 17, 176
Fsp4HI GCNGC 3 cut(s) 14, 131, 158
FspBI CTAG 2 cut(s) 203, 270
GluI GCNGC 3 cut(s) 14, 131, 158
HaeIII GGCC 1 cut(s) 243
Hin1II CATG 2 cut(s) 124, 225
HinfI GANTC 1 cut(s) 101
HphI GGTGA 1 cut(s) 29
Hpy188I TCNGA 4 cut(s) 100, 106, 211, 295
HpyAV CCTTC 1 cut(s) 51
HpyCH4V TGCA 3 cut(s) 13, 118, 130
HpyF3I CTNAG 1 cut(s) 105
Hsp92II CATG 2 cut(s) 124, 225
Kzo9I GATC 1 cut(s) 95
LmnI GCTCC 1 cut(s) 192
LpnPI CCDG 1 cut(s) 146
Lsp1109I GCAGC 3 cut(s) 25, 142, 144
MaeI CTAG 2 cut(s) 203, 270
MaeIII GTNAC 2 cut(s) 35, 263
MalI GATC 1 cut(s) 97
MboI GATC 1 cut(s) 95
MfeI CAATTG 1 cut(s) 31
MluCI AATT 2 cut(s) 31, 90
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 2 cut(s) 144, 147
MseI TTAA 1 cut(s) 251
MslI CAYNNNNRTG 1 cut(s) 125
MunI CAATTG 1 cut(s) 31
Mva1269I GAATGC 1 cut(s) 120
NdeII GATC 1 cut(s) 95
NlaIII CATG 2 cut(s) 124, 225
NlaIV GGNNCC 1 cut(s) 244
NmuCI GTSAC 1 cut(s) 35
PctI GAATGC 1 cut(s) 120
PfeI GAWTC 1 cut(s) 101
PkrI GCNGC 3 cut(s) 15, 132, 159
PspN4I GGNNCC 1 cut(s) 244
PspPI GGNCC 1 cut(s) 242
PstI CTGCAG 1 cut(s) 15
RseI CAYNNNNRTG 1 cut(s) 125
SaqAI TTAA 1 cut(s) 251
SatI GCNGC 3 cut(s) 14, 131, 158
Sau3AI GATC 1 cut(s) 95
Sau96I GGNCC 1 cut(s) 242
SetI ASST 3 cut(s) 52, 72, 204
SfcI CTRYAG 1 cut(s) 11
SgeI CNNG 9 cut(s) 72, 79, 133, 155, 173, 195, 215, 234, 282
SmiMI CAYNNNNRTG 1 cut(s) 125
Sse9I AATT 2 cut(s) 31, 90
SspMI CTAG 2 cut(s) 203, 270
TasI AATT 2 cut(s) 31, 90
TfiI GAWTC 1 cut(s) 101
Tru1I TTAA 1 cut(s) 251
Tru9I TTAA 1 cut(s) 251
TseFI GTSAC 1 cut(s) 35
TseI GCWGC 3 cut(s) 13, 130, 157
Tsp45I GTSAC 1 cut(s) 35
XspI CTAG 2 cut(s) 203, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.