Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003895.1

Orthogroup ID

OG0008916

Physical Location & Seq

Genomic Coordinates Reverse (-)

141693 .. 142349

Gene Structure 657 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003895.1_g000034.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 657 bp

atgtggatgcgccatgagggatataaggagttcataactgatatttggaggactttgcctgggaattttgttcagaaatctaagggccttgcttctgctttacagcattggtacaaatctatgtttggcaatatctttagacagaagaagattcttttagctagacttgctggtattcaaaaagctctttgtagaaagcataatcctttccttgtcaaattggaatctgatttgactaaagaatatgaggtcctcagagaaagggaaactatttactggaagcaaaagtcaagagagaaatgggtgaaagagggagatagaaacaccaaattctttcacctcaccactatgattagaagaagaagaaacaaggttgatggcctctttgatgctaatggtaattggtgtgacactccttctgctatgagaactattgcagttgacttctttaggaatcttttctctggagctgattggcatgatcttggatttcgtattcctatcttatttcctcgcattgatcagctcaccttgcaatctttgaaccatgatgtggatcttgaagaaaataaaaaggttaagttcagcattggagctttaaaggcacctggattcgacggatttcctgctaagtttttcaccaacattgggatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

C2 DUF4283 RVT_1 RVT_3 zf-RVT

Protein Analysis

218

Amino Acids

25.7

Weight (kDa)

9.9

Isoelectric Point (pI)

35.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008916)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G43940
fragaria_vesca	FvH4_6g25562
pyrus_communis	pycom04g06860 pycom08g15580
rosa_chinensis	RchiOBHm_Chr1g0321741 RchiOBHm_Chr4g0394881 RchiOBHm_Chr4g0426651 RchiOBHm_Chr6g0253621
rosa_laevigata	RLG00000020413
rosa_multiflora	Rmu_sc0003895.1_g000034 Rmu_sc0010958.1_g000004 Rmu_sc0011261.1_g000002 Rmu_ssc0000474.1_g000005
rosa_roxburghii	Rroxscaffold_1G00031210 Rroxscaffold_1G00048720 Rroxscaffold_2G00088920 Rroxscaffold_6G00409730
rosa_rugosa	Rorug02G0371000 Rorug07G0091500 Rorug07G0252000 Rorug07G0286400
rosa_wichuraiana	Rw5G037290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	604
AccB7I	CCANNNNNTGG	1 cut(s)	553
AclWI	GGATC	1 cut(s)	564
AcsI	RAATTY	2 cut(s)	64, 329
AfaI	GTAC	1 cut(s)	113
AfiI	CCNNNNNNNGG	2 cut(s)	553, 648
AgsI	TTSAA	3 cut(s)	179, 544, 563
AjnI	CCWGG	2 cut(s)	58, 607
AluBI	AGCT	5 cut(s)	161, 185, 470, 526, 596
AluI	AGCT	5 cut(s)	161, 185, 470, 526, 596
AlwI	GGATC	1 cut(s)	564
AoxI	GGCC	2 cut(s)	85, 379
ApoI	RAATTY	2 cut(s)	64, 329
Asp700I	GAANNNNTTC	1 cut(s)	458
AspLEI	GCGC	1 cut(s)	12
AspS9I	GGNCC	2 cut(s)	85, 250
AsuHPI	GGTGA	5 cut(s)	316, 329, 334, 520, 631
AvaII	GGWCC	1 cut(s)	250
BanI	GGYRCC	1 cut(s)	604
BccI	CCATC	1 cut(s)	371
BciT130I	CCWGG	2 cut(s)	60, 609
BclI	TGATCA	1 cut(s)	520
BfaI	CTAG	1 cut(s)	162
Bme1390I	CCNGG	2 cut(s)	60, 609
Bme18I	GGWCC	1 cut(s)	250
BmgT120I	GGNCC	2 cut(s)	85, 250
BmiI	GGNNCC	1 cut(s)	606
BmrFI	CCNGG	2 cut(s)	60, 609
BmsI	GCATC	1 cut(s)	379
BpmI	CTGGAG	1 cut(s)	486
BsaBI	GATNNNNATC	1 cut(s)	555
BsaJI	CCNNGG	1 cut(s)	59
Bsc4I	CCNNNNNNNGG	2 cut(s)	553, 648
Bse1I	ACTGG	1 cut(s)	281
Bse8I	GATNNNNATC	1 cut(s)	555
BseBI	CCWGG	2 cut(s)	60, 609
BseDI	CCNNGG	1 cut(s)	59
BseGI	GGATG	1 cut(s)	12
BseJI	GATNNNNATC	1 cut(s)	555
BseLI	CCNNNNNNNGG	2 cut(s)	553, 648
BseMII	CTCAG	1 cut(s)	268
BseNI	ACTGG	1 cut(s)	281
BshFI	GGCC	2 cut(s)	87, 381
BshNI	GGYRCC	1 cut(s)	604
BslI	CCNNNNNNNGG	2 cut(s)	553, 648
BsnI	GGCC	2 cut(s)	87, 381
Bsp143I	GATC	3 cut(s)	481, 520, 556
BspANI	GGCC	2 cut(s)	87, 381
BspCNI	CTCAG	1 cut(s)	267
BspLI	GGNNCC	1 cut(s)	606
BspPI	GGATC	1 cut(s)	564
BspT107I	GGYRCC	1 cut(s)	604
BsrI	ACTGG	1 cut(s)	281
BssECI	CCNNGG	1 cut(s)	59
BssMI	GATC	3 cut(s)	481, 520, 556
Bst2UI	CCWGG	2 cut(s)	60, 609
BstDEI	CTNAG	3 cut(s)	81, 254, 630
BstF5I	GGATG	1 cut(s)	12
BstHHI	GCGC	1 cut(s)	12
BstKTI	GATC	3 cut(s)	484, 523, 559
BstMBI	GATC	3 cut(s)	481, 520, 556
BstMWI	GCNNNNNNNGC	3 cut(s)	167, 532, 602
BstNI	CCWGG	2 cut(s)	60, 609
BstSCI	CCNGG	2 cut(s)	58, 607
BstX2I	RGATCY	1 cut(s)	556
BstYI	RGATCY	1 cut(s)	556
BsuRI	GGCC	2 cut(s)	87, 381
BtsCI	GGATG	1 cut(s)	12
CfoI	GCGC	1 cut(s)	12
Cfr13I	GGNCC	2 cut(s)	85, 250
Csp6I	GTAC	1 cut(s)	112
CviAII	CATG	3 cut(s)	14, 479, 548
CviJI	RGCY	7 cut(s)	87, 161, 185, 381, 470, 526, 596
CviKI_1	RGCY	7 cut(s)	87, 161, 185, 381, 470, 526, 596
CviQI	GTAC	1 cut(s)	112
DdeI	CTNAG	3 cut(s)	81, 254, 630
DpnI	GATC	3 cut(s)	483, 522, 558
DpnII	GATC	3 cut(s)	481, 520, 556
DraI	TTTAAA	1 cut(s)	600
Eco47I	GGWCC	1 cut(s)	250
EcoO109I	RGGNCCY	2 cut(s)	85, 250
EcoRII	CCWGG	2 cut(s)	58, 607
FaeI	CATG	3 cut(s)	17, 482, 551
FatI	CATG	3 cut(s)	13, 478, 547
FbaI	TGATCA	1 cut(s)	520
FokI	GGATG	1 cut(s)	19
FspBI	CTAG	1 cut(s)	162
GlaI	GCGC	1 cut(s)	11
GsuI	CTGGAG	1 cut(s)	486
HaeIII	GGCC	2 cut(s)	87, 381
HhaI	GCGC	1 cut(s)	12
Hin1II	CATG	3 cut(s)	17, 482, 551
Hin6I	GCGC	1 cut(s)	10
HinP1I	GCGC	1 cut(s)	10
HincII	GTYRAC	1 cut(s)	442
HindII	GTYRAC	1 cut(s)	442
HinfI	GANTC	4 cut(s)	151, 224, 454, 612
HphI	GGTGA	5 cut(s)	316, 329, 334, 520, 631
Hpy166II	GTNNAC	1 cut(s)	442
Hpy188I	TCNGA	3 cut(s)	75, 229, 257
Hpy188III	TCNNGA	3 cut(s)	291, 465, 560
Hpy8I	GTNNAC	1 cut(s)	442
Hpy99I	CGWCG	1 cut(s)	620
HpyAV	CCTTC	1 cut(s)	426
HpyCH4V	TGCA	2 cut(s)	437, 535
HpyF10VI	GCNNNNNNNGC	3 cut(s)	167, 532, 602
HpyF3I	CTNAG	3 cut(s)	81, 254, 630
Hsp92II	CATG	3 cut(s)	17, 482, 551
HspAI	GCGC	1 cut(s)	10
Ksp22I	TGATCA	1 cut(s)	520
Kzo9I	GATC	3 cut(s)	481, 520, 556
LmnI	GCTCC	2 cut(s)	467, 593
LpnPI	CCDG	8 cut(s)	45, 72, 156, 262, 450, 594, 621, 639
LweI	GCATC	1 cut(s)	379
MaeI	CTAG	1 cut(s)	162
MaeIII	GTNAC	1 cut(s)	407
MalI	GATC	3 cut(s)	483, 522, 558
MboI	GATC	3 cut(s)	481, 520, 556
MboII	GAAGA	6 cut(s)	157, 160, 369, 372, 375, 575
MflI	RGATCY	1 cut(s)	556
MluCI	AATT	4 cut(s)	64, 218, 329, 400
MnlI	CCTC	8 cut(s)	10, 42, 241, 263, 304, 350, 392, 522
MroXI	GAANNNNTTC	1 cut(s)	458
MseI	TTAA	2 cut(s)	579, 599
MslI	CAYNNNNRTG	1 cut(s)	347
MspR9I	CCNGG	2 cut(s)	60, 609
MvaI	CCWGG	2 cut(s)	60, 609
MwoI	GCNNNNNNNGC	3 cut(s)	167, 532, 602
NdeII	GATC	3 cut(s)	481, 520, 556
NlaIII	CATG	3 cut(s)	17, 482, 551
NlaIV	GGNNCC	1 cut(s)	606
NmuCI	GTSAC	1 cut(s)	407
PdmI	GAANNNNTTC	1 cut(s)	458
PfeI	GAWTC	4 cut(s)	151, 224, 454, 612
PflMI	CCANNNNNTGG	1 cut(s)	553
PpuMI	RGGWCCY	1 cut(s)	250
Psp5II	RGGWCCY	1 cut(s)	250
Psp6I	CCWGG	2 cut(s)	58, 607
PspGI	CCWGG	2 cut(s)	58, 607
PspN4I	GGNNCC	1 cut(s)	606
PspPI	GGNCC	2 cut(s)	85, 250
PspPPI	RGGWCCY	1 cut(s)	250
PsuI	RGATCY	1 cut(s)	556
RsaI	GTAC	1 cut(s)	113
RsaNI	GTAC	1 cut(s)	112
RseI	CAYNNNNRTG	1 cut(s)	347
SaqAI	TTAA	2 cut(s)	579, 599
Sau3AI	GATC	3 cut(s)	481, 520, 556
Sau96I	GGNCC	2 cut(s)	85, 250
ScrFI	CCNGG	2 cut(s)	60, 609
SfaNI	GCATC	1 cut(s)	379
SinI	GGWCC	1 cut(s)	250
SmiMI	CAYNNNNRTG	1 cut(s)	347
Sse9I	AATT	4 cut(s)	64, 218, 329, 400
SspMI	CTAG	1 cut(s)	162
StyD4I	CCNGG	2 cut(s)	58, 607
TaqI	TCGA	1 cut(s)	615
TasI	AATT	4 cut(s)	64, 218, 329, 400
TfiI	GAWTC	4 cut(s)	151, 224, 454, 612
Tru1I	TTAA	2 cut(s)	579, 599
Tru9I	TTAA	2 cut(s)	579, 599
TseFI	GTSAC	1 cut(s)	407
Tsp45I	GTSAC	1 cut(s)	407
TspDTI	ATGAA	1 cut(s)	22
TspGWI	ACGGA	1 cut(s)	633
Van91I	CCANNNNNTGG	1 cut(s)	553
VpaK11BI	GGWCC	1 cut(s)	250
XapI	RAATTY	2 cut(s)	64, 329
XmnI	GAANNNNTTC	1 cut(s)	458
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.