Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0011261.1

Orthogroup ID

OG0008916

Physical Location & Seq

Genomic Coordinates Forward (+)

4118 .. 4459

Gene Structure 342 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0011261.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 342 bp

atgcctgtttatgctatgcagactattaagattcccgcttctgtgtgtgatactattgagaaaatgagcagagagtttctttggggagataatgatggcagtaggaaggttcaccttgctaattgggacttagattgtaaaccaaagaggttcggtggattggggattaaaaatattagacacatgaaccaagctatgcttgccaaggtgggctggaggatgtttcaaaacgatgaaggattatggagcatggttttacatcaaaaatatgtgaaagatatcctctgttgcactatgaaaatggttgttcttctagaagttctagtacttggaggagtatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_1 RVT_3 zf-RVT

Protein Analysis

113

Amino Acids

12.94

Weight (kDa)

8.98

Isoelectric Point (pI)

46.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008916)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G43940
fragaria_vesca	FvH4_6g25562
pyrus_communis	pycom04g06860 pycom08g15580
rosa_chinensis	RchiOBHm_Chr1g0321741 RchiOBHm_Chr4g0394881 RchiOBHm_Chr4g0426651 RchiOBHm_Chr6g0253621
rosa_laevigata	RLG00000020413
rosa_multiflora	Rmu_sc0003895.1_g000034 Rmu_sc0010958.1_g000004 Rmu_sc0011261.1_g000002 Rmu_ssc0000474.1_g000005
rosa_roxburghii	Rroxscaffold_1G00031210 Rroxscaffold_1G00048720 Rroxscaffold_2G00088920 Rroxscaffold_6G00409730
rosa_rugosa	Rorug02G0371000 Rorug07G0091500 Rorug07G0252000 Rorug07G0286400
rosa_wichuraiana	Rw5G037290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	36
AfaI	GTAC	1 cut(s)	327
AgsI	TTSAA	1 cut(s)	227
AluBI	AGCT	1 cut(s)	194
AluI	AGCT	1 cut(s)	194
AsuHPI	GGTGA	1 cut(s)	104
BarI	GAAGNNNNNNTAC	2 cut(s)	309, 341
BccI	CCATC	1 cut(s)	89
BfaI	CTAG	2 cut(s)	314, 323
BmcAI	AGTACT	1 cut(s)	327
BpmI	CTGGAG	1 cut(s)	235
BsaJI	CCNNGG	1 cut(s)	204
BseDI	CCNNGG	1 cut(s)	204
BseGI	GGATG	1 cut(s)	225
BslFI	GGGAC	1 cut(s)	140
BsmFI	GGGAC	1 cut(s)	140
BspACI	CCGC	1 cut(s)	36
BssECI	CCNNGG	1 cut(s)	204
BssT1I	CCWWGG	1 cut(s)	204
BstC8I	GCNNGC	1 cut(s)	201
BstDEI	CTNAG	1 cut(s)	130
BstF5I	GGATG	1 cut(s)	225
BstMWI	GCNNNNNNNGC	1 cut(s)	200
BtsCI	GGATG	1 cut(s)	225
Cac8I	GCNNGC	1 cut(s)	201
Csp6I	GTAC	1 cut(s)	326
CviAII	CATG	2 cut(s)	184, 250
CviJI	RGCY	2 cut(s)	194, 213
CviKI_1	RGCY	2 cut(s)	194, 213
CviQI	GTAC	1 cut(s)	326
DdeI	CTNAG	1 cut(s)	130
Eco130I	CCWWGG	1 cut(s)	204
Eco32I	GATATC	1 cut(s)	280
EcoRV	GATATC	1 cut(s)	280
EcoT14I	CCWWGG	1 cut(s)	204
ErhI	CCWWGG	1 cut(s)	204
FaeI	CATG	2 cut(s)	187, 253
FaiI	YATR	9 cut(s)	12, 17, 185, 197, 244, 251, 270, 296, 340
FalI	AAGNNNNNCTT	2 cut(s)	183, 215
FaqI	GGGAC	1 cut(s)	140
FatI	CATG	2 cut(s)	183, 249
FauI	CCCGC	1 cut(s)	43
FokI	GGATG	1 cut(s)	232
FspBI	CTAG	2 cut(s)	314, 323
GsuI	CTGGAG	1 cut(s)	235
Hin1II	CATG	2 cut(s)	187, 253
HinfI	GANTC	1 cut(s)	31
HphI	GGTGA	1 cut(s)	104
Hpy166II	GTNNAC	2 cut(s)	112, 140
Hpy188III	TCNNGA	1 cut(s)	314
Hpy8I	GTNNAC	2 cut(s)	112, 140
HpyAV	CCTTC	2 cut(s)	100, 230
HpyCH4V	TGCA	2 cut(s)	19, 291
HpyF10VI	GCNNNNNNNGC	1 cut(s)	200
HpyF3I	CTNAG	1 cut(s)	130
Hsp92II	CATG	2 cut(s)	187, 253
LmnI	GCTCC	1 cut(s)	246
LpnPI	CCDG	2 cut(s)	18, 199
MaeI	CTAG	2 cut(s)	314, 323
MboII	GAAGA	1 cut(s)	302
MluCI	AATT	1 cut(s)	121
MnlI	CCTC	4 cut(s)	141, 210, 293, 326
MseI	TTAA	2 cut(s)	27, 168
MwoI	GCNNNNNNNGC	1 cut(s)	200
NlaIII	CATG	2 cut(s)	187, 253
PfeI	GAWTC	1 cut(s)	31
RsaI	GTAC	1 cut(s)	327
RsaNI	GTAC	1 cut(s)	326
SaqAI	TTAA	2 cut(s)	27, 168
ScaI	AGTACT	1 cut(s)	327
SetI	ASST	5 cut(s)	111, 117, 152, 196, 210
Sse9I	AATT	1 cut(s)	121
SsiI	CCGC	1 cut(s)	36
SspI	AATATT	1 cut(s)	175
SspMI	CTAG	2 cut(s)	314, 323
StyI	CCWWGG	1 cut(s)	204
TasI	AATT	1 cut(s)	121
TatI	WGTACW	1 cut(s)	325
TfiI	GAWTC	1 cut(s)	31
Tru1I	TTAA	2 cut(s)	27, 168
Tru9I	TTAA	2 cut(s)	27, 168
TspDTI	ATGAA	3 cut(s)	200, 249, 311
XbaI	TCTAGA	1 cut(s)	313
XspI	CTAG	2 cut(s)	314, 323
ZrmI	AGTACT	1 cut(s)	327

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.