Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr10

Orthogroup ID

OG0004157

Physical Location & Seq

Genomic Coordinates Forward (+)

13308644 .. 13308913

Gene Structure 270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

ATGTTTTATGAGGGAAACAAGTTTGAGACGAAATCAGTAGCAAGCGTCAATGGTAAAAAGTTATCGTTTTTACGAAACGGCACAGTGACAGGGGCGGGTTTATTGCCACAAGTTTCCGATCACACTACAGGTAATGCCATTCGCCCATTGCCACAAAGGAAAAGACCATATTTTGATATCTATAAGGTAATTGGAAGAAATAAATTTTTTCCATTAATTGCTGAAGTCTCAGAAATTCGAGTTTGTTTTCCCATTTTACTGACTTTATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009507 GO:0009536 GO:0009892 GO:0009893 GO:0009894 GO:0009895 GO:0009987 GO:0010468 GO:0010604 GO:0010605 GO:0010608 GO:0010628 GO:0016070 GO:0016787 GO:0016788 GO:0019219 GO:0019222 GO:0031323 GO:0031324 GO:0031329 GO:0031330 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0043487 GO:0043488 GO:0043489 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0045934 GO:0046483 GO:0048255 GO:0048518 GO:0048519 GO:0048523 GO:0050789 GO:0050794 GO:0051171 GO:0051172 GO:0051252 GO:0051253 GO:0060255 GO:0061013 GO:0065007 GO:0065008 GO:0071704 GO:0080090 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363 GO:1902369 GO:1902373 GO:1903311 GO:1903312

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

PPR PPR_2 PPR_3

Protein Analysis

90

Amino Acids

10.02

Weight (kDa)

10.01

Isoelectric Point (pI)

37.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004157)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G34830
fragaria_vesca	FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240 FvH4_2g02240
malus_domestica	MD05G1113900.v1.1
prunus_persica	Prupe.8G158300_v2.0.a1 Prupe.8G158300_v2.0.a1 Prupe.8G158300_v2.0.a1
pyrus_communis	pycom05g10870 pycom10g10060
rosa_chinensis	RchiOBHm_Chr6g0245931
rosa_laevigata	RLG00000015285
rosa_multiflora	Rmu_co8211740.1_g000001 Rmu_sc0005570.1_g000001 Rmu_sc0018377.1_g000001 Rmu_sc0018378.1_g000004
rosa_roxburghii	Rroxscaffold_7G00215060
rosa_rugosa	Rorug05G0517500
rosa_samantha	Rh6AG031800 Rh6BG028200 Rh6CG028200 Rh6DG027500
rosa_wichuraiana	Rw6G002660

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	95
AcsI	RAATTY	2 cut(s)	203, 234
AcuI	CTGAAG	1 cut(s)	243
Alw26I	GTCTC	2 cut(s)	20, 232
ApoI	RAATTY	2 cut(s)	203, 234
AseI	ATTAAT	1 cut(s)	215
BceAI	ACGGC	1 cut(s)	94
BcoDI	GTCTC	2 cut(s)	20, 232
BfmI	CTRYAG	1 cut(s)	126
Bse3DI	GCAATG	1 cut(s)	146
BseMI	GCAATG	1 cut(s)	146
BseMII	CTCAG	1 cut(s)	243
BsmAI	GTCTC	2 cut(s)	20, 232
BsmBI	CGTCTC	1 cut(s)	20
Bsp143I	GATC	1 cut(s)	118
BspACI	CCGC	1 cut(s)	95
BspCNI	CTCAG	1 cut(s)	242
BsrDI	GCAATG	1 cut(s)	146
BssMI	GATC	1 cut(s)	118
Bst4CI	ACNGT	1 cut(s)	85
BstC8I	GCNNGC	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	229
BstKTI	GATC	1 cut(s)	121
BstMAI	GTCTC	2 cut(s)	20, 232
BstMBI	GATC	1 cut(s)	118
BstSFI	CTRYAG	1 cut(s)	126
BtsIMutI	CAGTG	1 cut(s)	90
Cac8I	GCNNGC	1 cut(s)	43
CseI	GACGC	1 cut(s)	34
DdeI	CTNAG	1 cut(s)	229
DpnI	GATC	1 cut(s)	120
DpnII	GATC	1 cut(s)	118
Eco32I	GATATC	1 cut(s)	178
Eco57I	CTGAAG	1 cut(s)	243
EcoRV	GATATC	1 cut(s)	178
Esp3I	CGTCTC	1 cut(s)	20
FaiI	YATR	4 cut(s)	9, 169, 183, 268
FauI	CCCGC	1 cut(s)	88
HgaI	GACGC	1 cut(s)	34
Hpy188I	TCNGA	2 cut(s)	118, 232
HpyCH4III	ACNGT	1 cut(s)	85
HpyF3I	CTNAG	1 cut(s)	229
Kzo9I	GATC	1 cut(s)	118
LpnPI	CCDG	2 cut(s)	75, 114
MaeIII	GTNAC	1 cut(s)	85
MalI	GATC	1 cut(s)	120
MboI	GATC	1 cut(s)	118
MboII	GAAGA	1 cut(s)	207
MluCI	AATT	4 cut(s)	189, 203, 216, 234
MnlI	CCTC	1 cut(s)	4
MseI	TTAA	1 cut(s)	215
NdeII	GATC	1 cut(s)	118
NmuCI	GTSAC	1 cut(s)	85
PshBI	ATTAAT	1 cut(s)	215
SaqAI	TTAA	1 cut(s)	215
Sau3AI	GATC	1 cut(s)	118
SetI	ASST	2 cut(s)	133, 189
SfcI	CTRYAG	1 cut(s)	126
SgeI	CNNG	7 cut(s)	31, 54, 102, 108, 122, 141, 251
Sse9I	AATT	4 cut(s)	189, 203, 216, 234
SsiI	CCGC	1 cut(s)	95
TaaI	ACNGT	1 cut(s)	85
TaqI	TCGA	1 cut(s)	238
TasI	AATT	4 cut(s)	189, 203, 216, 234
Tru1I	TTAA	1 cut(s)	215
Tru9I	TTAA	1 cut(s)	215
TscAI	CASTG	1 cut(s)	90
TseFI	GTSAC	1 cut(s)	85
Tsp45I	GTSAC	1 cut(s)	85
TspRI	CASTG	1 cut(s)	90
VspI	ATTAAT	1 cut(s)	215
XapI	RAATTY	2 cut(s)	203, 234

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.