Rmu_co8211740.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8211740.1
Physical Location & Seq
Forward (+)
1 .. 526
526 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8211740.1_g000001.1.cds

Sequence Viewer

Length: 331 bp
gttatccgattctttgagattgcttgaagatttggagaaaaaggatttgttggatatgaataaggtttatcatggaaggttttttgaaacctgcaaaaagaaaaaggctgttgatcaagcttttcgtttcatcaaactgattccaaatccaacaatgagtacatataatatgcttatgtctgtctgtgcgagtgctcaagattcagagggtgctttcaatgttctgggacttgtccgggaggctgggctaagagttgattgcaaactttacactactctgatatcaacatgtgcgaaaagtggaaaagtctacactatgtttgatgtatga

Protein Analysis

109

Amino Acids

12.33

Weight (kDa)

8.7

Isoelectric Point (pI)

22.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 99
AccI GTMKAC 1 cut(s) 310
AfaI GTAC 1 cut(s) 161
AflIII ACRYGT 1 cut(s) 288
AgsI TTSAA 3 cut(s) 27, 87, 218
AluBI AGCT 1 cut(s) 120
AluI AGCT 1 cut(s) 120
Alw21I GWGCWC 1 cut(s) 197
AsuC2I CCSGG 1 cut(s) 237
Bbv12I GWGCWC 1 cut(s) 197
BclI TGATCA 1 cut(s) 113
BcnI CCSGG 1 cut(s) 237
BfuAI ACCTGC 1 cut(s) 99
Bme1390I CCNGG 1 cut(s) 237
BmrFI CCNGG 1 cut(s) 237
BpuEI CTTGAG 1 cut(s) 181
BpuMI CCSGG 1 cut(s) 237
BseYI CCCAGC 1 cut(s) 243
BsiHKAI GWGCWC 1 cut(s) 197
BsiSI CCGG 1 cut(s) 236
BslFI GGGAC 1 cut(s) 241
BsmFI GGGAC 1 cut(s) 241
Bsp1286I GDGCHC 1 cut(s) 197
Bsp143I GATC 1 cut(s) 113
BspMI ACCTGC 1 cut(s) 99
BssMI GATC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 249
BstKTI GATC 1 cut(s) 116
BstMBI GATC 1 cut(s) 113
BstNSI RCATGY 1 cut(s) 292
BstSCI CCNGG 1 cut(s) 235
BveI ACCTGC 1 cut(s) 99
Csp6I GTAC 1 cut(s) 160
CviAII CATG 2 cut(s) 72, 289
CviJI RGCY 4 cut(s) 108, 120, 243, 248
CviKI_1 RGCY 4 cut(s) 108, 120, 243, 248
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 249
DpnI GATC 1 cut(s) 115
DpnII GATC 1 cut(s) 113
Eco32I GATATC 1 cut(s) 283
EcoRV GATATC 1 cut(s) 283
FaeI CATG 2 cut(s) 75, 292
FaiI YATR 9 cut(s) 57, 73, 164, 166, 171, 177, 290, 318, 329
FaqI GGGAC 1 cut(s) 241
FatI CATG 2 cut(s) 71, 288
FbaI TGATCA 1 cut(s) 113
FblI GTMKAC 1 cut(s) 310
GsaI CCCAGC 1 cut(s) 247
HapII CCGG 1 cut(s) 236
Hin1II CATG 2 cut(s) 75, 292
HindIII AAGCTT 1 cut(s) 118
HinfI GANTC 3 cut(s) 9, 140, 201
HpaII CCGG 1 cut(s) 236
Hpy166II GTNNAC 1 cut(s) 311
Hpy188I TCNGA 3 cut(s) 8, 206, 280
Hpy188III TCNNGA 1 cut(s) 198
Hpy8I GTNNAC 1 cut(s) 311
HpyAV CCTTC 1 cut(s) 70
HpyCH4V TGCA 2 cut(s) 94, 262
HpyF3I CTNAG 1 cut(s) 249
Hsp92II CATG 2 cut(s) 75, 292
Ksp22I TGATCA 1 cut(s) 113
Kzo9I GATC 1 cut(s) 113
LpnPI CCDG 4 cut(s) 104, 210, 229, 249
MalI GATC 1 cut(s) 115
MboI GATC 1 cut(s) 113
MboII GAAGA 1 cut(s) 39
MhlI GDGCHC 1 cut(s) 197
MmeI TCCRAC 2 cut(s) 31, 174
MnlI CCTC 2 cut(s) 200, 233
MspI CCGG 1 cut(s) 236
MspR9I CCNGG 1 cut(s) 237
NciI CCSGG 1 cut(s) 237
NdeII GATC 1 cut(s) 113
NlaIII CATG 2 cut(s) 75, 292
NspI RCATGY 1 cut(s) 292
PciI ACATGT 1 cut(s) 288
PfeI GAWTC 3 cut(s) 9, 140, 201
PfoI TCCNGGA 1 cut(s) 235
PscI ACATGT 1 cut(s) 288
PspFI CCCAGC 1 cut(s) 243
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 113
ScrFI CCNGG 1 cut(s) 237
SduI GDGCHC 1 cut(s) 197
SetI ASST 4 cut(s) 67, 81, 93, 122
SmlI CTYRAG 1 cut(s) 196
SmoI CTYRAG 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 235
TatI WGTACW 1 cut(s) 159
TfiI GAWTC 3 cut(s) 9, 140, 201
TspDTI ATGAA 2 cut(s) 72, 119
XceI RCATGY 1 cut(s) 292
XmiI GTMKAC 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.