Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr10

Orthogroup ID

OG0005017

Physical Location & Seq

Genomic Coordinates Forward (+)

13713008 .. 13713361

Gene Structure 354 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom10g10440.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ATGGCTGCAGCAGCTAGCTCAACTTCCTCACTGTACGAGGTTCTTGGCCTTCCAATGGGTGCAAGTGGCCATGAGATCAAGGCAGCCTACAGAAAGCTAGCCAGAAGGTGCCATCCTGACGTTGTCGCCATGGACCAAAAGCAAAACTCTACTAATGAGTTCATGAAAATCCATGCAGCTTACGCAACGCTATCGGACCCCGATAAAAGAGCAAACTACGACAGGGATCTTTATAGATGTCCCCAACCTTTCCAATCTTCGTACTCGTCGGCGAACATGGCTGCTGCCGCTTCGGCAATGGCGGGGTCTTCCCGACGGACTAATAGGAATTGGGAGACTGACCAATGTTGGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ

Protein Analysis

118

Amino Acids

12.93

Weight (kDa)

8.86

Isoelectric Point (pI)

48.07

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
DnaJ	PF00226	11 - 74	9.9e-22	DnaJ domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005017)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G17880 AT4G36040
fragaria_vesca	FvH4_1g11760 FvH4_2g01600
malus_domestica	MD02G1131800.v1.1 MD10G1121200.v1.1 MD15G1244700.v1.1
prunus_persica	Prupe.7G168700_v2.0.a1 Prupe.8G162800_v2.0.a1
pyrus_communis	pycom02g10270 pycom10g10440
rosa_chinensis	RchiOBHm_Chr2g0099371 RchiOBHm_Chr6g0244331
rosa_laevigata	RLG00000015366 RLG00000016876
rosa_multiflora	Rmu_sc0006898.1_g000007
rosa_roxburghii	Rroxscaffold_2G00143130 Rroxscaffold_7G00215880
rosa_rugosa	Rorug02G0078900 Rorug05G0508000.1
rosa_samantha	Rh2AG128900 Rh2BG131900 Rh2CG132700 Rh2DG132900 Rh6AG023100 Rh6BG018800 Rh6CG016100 Rh6DG017200
rosa_wichuraiana	Rw2G009920 Rw6G001910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	108
AciI	CCGC	2 cut(s)	288, 302
AclWI	GGATC	1 cut(s)	234
AcoI	YGGCCR	1 cut(s)	67
AfaI	GTAC	2 cut(s)	35, 263
AfiI	CCNNNNNNNGG	1 cut(s)	55
AluBI	AGCT	4 cut(s)	14, 18, 97, 179
AluI	AGCT	4 cut(s)	14, 18, 97, 179
Alw26I	GTCTC	1 cut(s)	329
AlwI	GGATC	1 cut(s)	234
AoxI	GGCC	2 cut(s)	46, 67
ApeKI	GCWGC	7 cut(s)	5, 8, 11, 83, 176, 281, 284
AspS9I	GGNCC	2 cut(s)	133, 196
AsuNHI	GCTAGC	2 cut(s)	14, 97
AvaII	GGWCC	2 cut(s)	133, 196
BalI	TGGCCA	1 cut(s)	69
BanI	GGYRCC	1 cut(s)	108
BbsI	GAAGAC	1 cut(s)	300
BbvI	GCAGC	6 cut(s)	20, 23, 95, 188, 268, 271
BccI	CCATC	1 cut(s)	120
BcgI	CGANNNNNNTGC	2 cut(s)	174, 208
BcoDI	GTCTC	1 cut(s)	329
BfaI	CTAG	2 cut(s)	15, 98
BfmI	CTRYAG	2 cut(s)	6, 88
BglI	GCCNNNNNGGC	1 cut(s)	293
BisI	GCNGC	8 cut(s)	6, 9, 12, 84, 177, 282, 285, 288
BlsI	GCNGC	8 cut(s)	7, 10, 13, 85, 178, 283, 286, 289
Bme18I	GGWCC	2 cut(s)	133, 196
BmgT120I	GGNCC	2 cut(s)	133, 196
BmiI	GGNNCC	2 cut(s)	110, 198
BmtI	GCTAGC	2 cut(s)	18, 101
BpiI	GAAGAC	1 cut(s)	300
BsaJI	CCNNGG	1 cut(s)	129
Bsc4I	CCNNNNNNNGG	1 cut(s)	55
Bse3DI	GCAATG	1 cut(s)	303
BseDI	CCNNGG	1 cut(s)	129
BseGI	GGATG	1 cut(s)	112
BseLI	CCNNNNNNNGG	1 cut(s)	55
BseMI	GCAATG	1 cut(s)	303
BseXI	GCAGC	6 cut(s)	20, 23, 95, 188, 268, 271
BshFI	GGCC	2 cut(s)	48, 69
BshNI	GGYRCC	1 cut(s)	108
BslFI	GGGAC	1 cut(s)	225
BslI	CCNNNNNNNGG	1 cut(s)	55
BsmAI	GTCTC	1 cut(s)	329
BsmFI	GGGAC	1 cut(s)	225
BsnI	GGCC	2 cut(s)	48, 69
Bsp143I	GATC	2 cut(s)	75, 226
Bsp19I	CCATGG	1 cut(s)	129
BspACI	CCGC	2 cut(s)	288, 302
BspANI	GGCC	2 cut(s)	48, 69
BspHI	TCATGA	1 cut(s)	162
BspLI	GGNNCC	2 cut(s)	110, 198
BspMAI	CTGCAG	1 cut(s)	10
BspOI	GCTAGC	2 cut(s)	18, 101
BspPI	GGATC	1 cut(s)	234
BspT107I	GGYRCC	1 cut(s)	108
BsrDI	GCAATG	1 cut(s)	303
BssECI	CCNNGG	1 cut(s)	129
BssMI	GATC	2 cut(s)	75, 226
BssT1I	CCWWGG	1 cut(s)	129
Bst4CI	ACNGT	1 cut(s)	33
BstC8I	GCNNGC	2 cut(s)	16, 99
BstDSI	CCRYGG	1 cut(s)	129
BstF5I	GGATG	1 cut(s)	112
BstKTI	GATC	2 cut(s)	78, 229
BstMAI	GTCTC	1 cut(s)	329
BstMBI	GATC	2 cut(s)	75, 226
BstMWI	GCNNNNNNNGC	5 cut(s)	11, 182, 278, 287, 293
BstSFI	CTRYAG	2 cut(s)	6, 88
BstV1I	GCAGC	6 cut(s)	20, 23, 95, 188, 268, 271
BstV2I	GAAGAC	1 cut(s)	300
BstX2I	RGATCY	1 cut(s)	226
BstYI	RGATCY	1 cut(s)	226
BsuRI	GGCC	2 cut(s)	48, 69
BtgI	CCRYGG	1 cut(s)	129
BtsCI	GGATG	1 cut(s)	112
BtsIMutI	CAGTG	1 cut(s)	29
Cac8I	GCNNGC	2 cut(s)	16, 99
CciI	TCATGA	1 cut(s)	162
Cfr13I	GGNCC	2 cut(s)	133, 196
Csp6I	GTAC	2 cut(s)	34, 262
CviAII	CATG	5 cut(s)	71, 130, 163, 173, 277
CviQI	GTAC	2 cut(s)	34, 262
DpnI	GATC	2 cut(s)	77, 228
DpnII	GATC	2 cut(s)	75, 226
EaeI	YGGCCR	1 cut(s)	67
Eco130I	CCWWGG	1 cut(s)	129
Eco47I	GGWCC	2 cut(s)	133, 196
EcoT14I	CCWWGG	1 cut(s)	129
ErhI	CCWWGG	1 cut(s)	129
FaeI	CATG	5 cut(s)	74, 133, 166, 176, 280
FaiI	YATR	6 cut(s)	72, 131, 164, 174, 234, 278
FaqI	GGGAC	1 cut(s)	225
FatI	CATG	5 cut(s)	70, 129, 162, 172, 276
FauI	CCCGC	1 cut(s)	295
Fnu4HI	GCNGC	8 cut(s)	6, 9, 12, 84, 177, 282, 285, 288
FokI	GGATG	1 cut(s)	99
Fsp4HI	GCNGC	8 cut(s)	6, 9, 12, 84, 177, 282, 285, 288
FspBI	CTAG	2 cut(s)	15, 98
GluI	GCNGC	8 cut(s)	6, 9, 12, 84, 177, 282, 285, 288
HaeIII	GGCC	2 cut(s)	48, 69
Hin1II	CATG	5 cut(s)	74, 133, 166, 176, 280
Hpy188I	TCNGA	1 cut(s)	196
Hpy188III	TCNNGA	3 cut(s)	116, 163, 312
Hpy99I	CGWCG	2 cut(s)	271, 318
HpyAV	CCTTC	2 cut(s)	59, 99
HpyCH4III	ACNGT	1 cut(s)	33
HpyCH4IV	ACGT	1 cut(s)	120
HpyCH4V	TGCA	3 cut(s)	8, 62, 176
HpyF10VI	GCNNNNNNNGC	5 cut(s)	11, 182, 278, 287, 293
HpySE526I	ACGT	1 cut(s)	120
Hsp92II	CATG	5 cut(s)	74, 133, 166, 176, 280
Kzo9I	GATC	2 cut(s)	75, 226
LpnPI	CCDG	3 cut(s)	115, 129, 208
Lsp1109I	GCAGC	6 cut(s)	20, 23, 95, 188, 268, 271
MaeI	CTAG	2 cut(s)	15, 98
MaeII	ACGT	1 cut(s)	120
MalI	GATC	2 cut(s)	77, 228
MboI	GATC	2 cut(s)	75, 226
MboII	GAAGA	2 cut(s)	249, 300
MflI	RGATCY	1 cut(s)	226
MlsI	TGGCCA	1 cut(s)	69
MluCI	AATT	1 cut(s)	328
MluNI	TGGCCA	1 cut(s)	69
MnlI	CCTC	2 cut(s)	31, 37
Mox20I	TGGCCA	1 cut(s)	69
MscI	TGGCCA	1 cut(s)	69
Msp20I	TGGCCA	1 cut(s)	69
MwoI	GCNNNNNNNGC	5 cut(s)	11, 182, 278, 287, 293
NcoI	CCATGG	1 cut(s)	129
NdeII	GATC	2 cut(s)	75, 226
NheI	GCTAGC	2 cut(s)	14, 97
NlaIII	CATG	5 cut(s)	74, 133, 166, 176, 280
NlaIV	GGNNCC	2 cut(s)	110, 198
PagI	TCATGA	1 cut(s)	162
PflFI	GACNNNGTC	1 cut(s)	122
PkrI	GCNGC	8 cut(s)	7, 10, 13, 85, 178, 283, 286, 289
PspN4I	GGNNCC	2 cut(s)	110, 198
PspPI	GGNCC	2 cut(s)	133, 196
PstI	CTGCAG	1 cut(s)	10
PsuI	RGATCY	1 cut(s)	226
PsyI	GACNNNGTC	1 cut(s)	122
RsaI	GTAC	2 cut(s)	35, 263
RsaNI	GTAC	2 cut(s)	34, 262
SatI	GCNGC	8 cut(s)	6, 9, 12, 84, 177, 282, 285, 288
Sau3AI	GATC	2 cut(s)	75, 226
Sau96I	GGNCC	2 cut(s)	133, 196
SetI	ASST	8 cut(s)	16, 20, 42, 99, 110, 123, 181, 250
SfcI	CTRYAG	2 cut(s)	6, 88
SinI	GGWCC	2 cut(s)	133, 196
Sse9I	AATT	1 cut(s)	328
SsiI	CCGC	2 cut(s)	288, 302
SspMI	CTAG	2 cut(s)	15, 98
StyI	CCWWGG	1 cut(s)	129
TaaI	ACNGT	1 cut(s)	33
TaiI	ACGT	1 cut(s)	123
TasI	AATT	1 cut(s)	328
TauI	GCSGC	1 cut(s)	290
TscAI	CASTG	1 cut(s)	36
TseI	GCWGC	7 cut(s)	5, 8, 11, 83, 176, 281, 284
TspDTI	ATGAA	2 cut(s)	151, 179
TspGWI	ACGGA	1 cut(s)	331
TspRI	CASTG	1 cut(s)	36
Tth111I	GACNNNGTC	1 cut(s)	122
VpaK11BI	GGWCC	2 cut(s)	133, 196
XspI	CTAG	2 cut(s)	15, 98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.