Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006898.1

Orthogroup ID

OG0005017

Physical Location & Seq

Genomic Coordinates Forward (+)

26405 .. 26737

Gene Structure 333 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006898.1_g000007.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 333 bp

atggcaactgcagctagtccaacttcatcgctgtacgaagttcttggccttccaatgagtgcaagtggtcaggagatcaaagcagcttataggagactagcaaggaggtgtcacccagatgttgtggccatgaaccaaaaacaaacctctgctactgaattcatgaagattcatgcagcttatgcaaccctatcggaccctgaaaaacgagcaaactacgataggggtctttaccggtgtgctcggcctttcgggtcttcgtcttcattttcctccgcaacagctgcggcagcaaatacttaccggaactgggagactgaccagtgctggtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DnaJ

Protein Analysis

110

Amino Acids

12.12

Weight (kDa)

9.15

Isoelectric Point (pI)

54.04

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005017)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G17880 AT4G36040
fragaria_vesca	FvH4_1g11760 FvH4_2g01600
malus_domestica	MD02G1131800.v1.1 MD10G1121200.v1.1 MD15G1244700.v1.1
prunus_persica	Prupe.7G168700_v2.0.a1 Prupe.8G162800_v2.0.a1
pyrus_communis	pycom02g10270 pycom10g10440
rosa_chinensis	RchiOBHm_Chr2g0099371 RchiOBHm_Chr6g0244331
rosa_laevigata	RLG00000015366 RLG00000016876
rosa_multiflora	Rmu_sc0006898.1_g000007
rosa_roxburghii	Rroxscaffold_2G00143130 Rroxscaffold_7G00215880
rosa_rugosa	Rorug02G0078900 Rorug05G0508000.1
rosa_samantha	Rh2AG128900 Rh2BG131900 Rh2CG132700 Rh2DG132900 Rh6AG023100 Rh6BG018800 Rh6CG016100 Rh6DG017200
rosa_wichuraiana	Rw2G009920 Rw6G001910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	276, 287
AcoI	YGGCCR	1 cut(s)	126
AcsI	RAATTY	1 cut(s)	158
AfaI	GTAC	1 cut(s)	35
AfiI	CCNNNNNNNGG	1 cut(s)	310
AgeI	ACCGGT	1 cut(s)	234
AluBI	AGCT	4 cut(s)	14, 86, 179, 284
AluI	AGCT	4 cut(s)	14, 86, 179, 284
Alw21I	GWGCWC	1 cut(s)	244
Alw26I	GTCTC	2 cut(s)	88, 308
AoxI	GGCC	3 cut(s)	46, 126, 245
ApeKI	GCWGC	5 cut(s)	11, 83, 176, 284, 290
ApoI	RAATTY	1 cut(s)	158
AsiGI	ACCGGT	1 cut(s)	234
AspS9I	GGNCC	1 cut(s)	196
AsuHPI	GGTGA	1 cut(s)	104
AvaII	GGWCC	1 cut(s)	196
BalI	TGGCCA	1 cut(s)	128
BbsI	GAAGAC	2 cut(s)	249, 255
Bbv12I	GWGCWC	1 cut(s)	244
BbvI	GCAGC	5 cut(s)	23, 95, 188, 271, 302
BcgI	CGANNNNNNTGC	2 cut(s)	174, 208
BcoDI	GTCTC	2 cut(s)	88, 308
BfaI	CTAG	2 cut(s)	15, 98
BfmI	CTRYAG	1 cut(s)	9
BisI	GCNGC	6 cut(s)	12, 84, 177, 285, 288, 291
BlsI	GCNGC	6 cut(s)	13, 85, 178, 286, 289, 292
Bme18I	GGWCC	1 cut(s)	196
BmgT120I	GGNCC	1 cut(s)	196
BmiI	GGNNCC	1 cut(s)	198
BmrI	ACTGGG	1 cut(s)	319
BmuI	ACTGGG	1 cut(s)	319
BpiI	GAAGAC	2 cut(s)	249, 255
BsaWI	WCCGGW	2 cut(s)	234, 303
Bsc4I	CCNNNNNNNGG	1 cut(s)	310
Bse118I	RCCGGY	1 cut(s)	234
Bse1I	ACTGG	2 cut(s)	314, 322
BseLI	CCNNNNNNNGG	1 cut(s)	310
BseNI	ACTGG	2 cut(s)	314, 322
BseXI	GCAGC	5 cut(s)	23, 95, 188, 271, 302
BshFI	GGCC	3 cut(s)	48, 128, 247
BshTI	ACCGGT	1 cut(s)	234
BsiHKAI	GWGCWC	1 cut(s)	244
BsiSI	CCGG	2 cut(s)	235, 304
BslI	CCNNNNNNNGG	1 cut(s)	310
BsmAI	GTCTC	2 cut(s)	88, 308
BsnI	GGCC	3 cut(s)	48, 128, 247
Bsp1286I	GDGCHC	1 cut(s)	244
Bsp143I	GATC	1 cut(s)	75
BspACI	CCGC	2 cut(s)	276, 287
BspANI	GGCC	3 cut(s)	48, 128, 247
BspHI	TCATGA	1 cut(s)	162
BspLI	GGNNCC	1 cut(s)	198
BspMAI	CTGCAG	1 cut(s)	13
BsrFI	RCCGGY	1 cut(s)	234
BsrI	ACTGG	2 cut(s)	314, 322
BssAI	RCCGGY	1 cut(s)	234
BssMI	GATC	1 cut(s)	75
BstAPI	GCANNNNNTGC	2 cut(s)	182, 284
BstKTI	GATC	1 cut(s)	78
BstMAI	GTCTC	2 cut(s)	88, 308
BstMBI	GATC	1 cut(s)	75
BstMWI	GCNNNNNNNGC	4 cut(s)	11, 182, 284, 290
BstSFI	CTRYAG	1 cut(s)	9
BstV1I	GCAGC	5 cut(s)	23, 95, 188, 271, 302
BstV2I	GAAGAC	2 cut(s)	249, 255
BsuRI	GGCC	3 cut(s)	48, 128, 247
BtgZI	GCGATG	1 cut(s)	12
BtsIMutI	CAGTG	1 cut(s)	329
CciI	TCATGA	1 cut(s)	162
Cfr10I	RCCGGY	1 cut(s)	234
Cfr13I	GGNCC	1 cut(s)	196
Csp6I	GTAC	1 cut(s)	34
CspAI	ACCGGT	1 cut(s)	234
CviAII	CATG	3 cut(s)	130, 163, 173
CviJI	RGCY	7 cut(s)	14, 48, 86, 128, 179, 247, 284
CviKI_1	RGCY	7 cut(s)	14, 48, 86, 128, 179, 247, 284
CviQI	GTAC	1 cut(s)	34
DpnI	GATC	1 cut(s)	77
DpnII	GATC	1 cut(s)	75
EaeI	YGGCCR	1 cut(s)	126
Eco47I	GGWCC	1 cut(s)	196
EcoRI	GAATTC	1 cut(s)	158
FaeI	CATG	3 cut(s)	133, 166, 176
FaiI	YATR	5 cut(s)	90, 131, 164, 174, 183
FatI	CATG	3 cut(s)	129, 162, 172
Fnu4HI	GCNGC	6 cut(s)	12, 84, 177, 285, 288, 291
Fsp4HI	GCNGC	6 cut(s)	12, 84, 177, 285, 288, 291
FspBI	CTAG	2 cut(s)	15, 98
GluI	GCNGC	6 cut(s)	12, 84, 177, 285, 288, 291
HaeIII	GGCC	3 cut(s)	48, 128, 247
HapII	CCGG	2 cut(s)	235, 304
Hin1II	CATG	3 cut(s)	133, 166, 176
HinfI	GANTC	1 cut(s)	169
HpaII	CCGG	2 cut(s)	235, 304
HphI	GGTGA	1 cut(s)	104
Hpy188I	TCNGA	1 cut(s)	196
Hpy188III	TCNNGA	2 cut(s)	71, 163
HpyAV	CCTTC	1 cut(s)	59
HpyCH4V	TGCA	4 cut(s)	11, 62, 176, 185
HpyF10VI	GCNNNNNNNGC	4 cut(s)	11, 182, 284, 290
Hsp92II	CATG	3 cut(s)	133, 166, 176
Kzo9I	GATC	1 cut(s)	75
LpnPI	CCDG	7 cut(s)	56, 129, 213, 248, 295, 313, 317
Lsp1109I	GCAGC	5 cut(s)	23, 95, 188, 271, 302
MaeI	CTAG	2 cut(s)	15, 98
MaeIII	GTNAC	1 cut(s)	110
MalI	GATC	1 cut(s)	77
MboI	GATC	1 cut(s)	75
MboII	GAAGA	3 cut(s)	178, 249, 255
MhlI	GDGCHC	1 cut(s)	244
MlsI	TGGCCA	1 cut(s)	128
MluCI	AATT	1 cut(s)	158
MluNI	TGGCCA	1 cut(s)	128
MmeI	TCCRAC	1 cut(s)	44
MnlI	CCTC	3 cut(s)	99, 157, 283
Mox20I	TGGCCA	1 cut(s)	128
MscI	TGGCCA	1 cut(s)	128
MslI	CAYNNNNRTG	1 cut(s)	117
Msp20I	TGGCCA	1 cut(s)	128
MspA1I	CMGCKG	1 cut(s)	284
MspI	CCGG	2 cut(s)	235, 304
MwoI	GCNNNNNNNGC	4 cut(s)	11, 182, 284, 290
NdeII	GATC	1 cut(s)	75
NlaIII	CATG	3 cut(s)	133, 166, 176
NlaIV	GGNNCC	1 cut(s)	198
NmeAIII	GCCGAG	1 cut(s)	223
NmuCI	GTSAC	1 cut(s)	110
PagI	TCATGA	1 cut(s)	162
PfeI	GAWTC	1 cut(s)	169
PinAI	ACCGGT	1 cut(s)	234
PkrI	GCNGC	6 cut(s)	13, 85, 178, 286, 289, 292
PspN4I	GGNNCC	1 cut(s)	198
PspPI	GGNCC	1 cut(s)	196
PstI	CTGCAG	1 cut(s)	13
PvuII	CAGCTG	1 cut(s)	284
RsaI	GTAC	1 cut(s)	35
RsaNI	GTAC	1 cut(s)	34
RseI	CAYNNNNRTG	1 cut(s)	117
SatI	GCNGC	6 cut(s)	12, 84, 177, 285, 288, 291
Sau3AI	GATC	1 cut(s)	75
Sau96I	GGNCC	1 cut(s)	196
SduI	GDGCHC	1 cut(s)	244
SetI	ASST	6 cut(s)	16, 88, 110, 149, 181, 286
SfcI	CTRYAG	1 cut(s)	9
SinI	GGWCC	1 cut(s)	196
SmiMI	CAYNNNNRTG	1 cut(s)	117
Sse9I	AATT	1 cut(s)	158
SsiI	CCGC	2 cut(s)	276, 287
SspMI	CTAG	2 cut(s)	15, 98
TasI	AATT	1 cut(s)	158
TauI	GCSGC	1 cut(s)	290
TfiI	GAWTC	1 cut(s)	169
TscAI	CASTG	1 cut(s)	329
TseFI	GTSAC	1 cut(s)	110
TseI	GCWGC	5 cut(s)	11, 83, 176, 284, 290
Tsp45I	GTSAC	1 cut(s)	110
TspDTI	ATGAA	6 cut(s)	15, 146, 151, 161, 179, 255
TspRI	CASTG	1 cut(s)	329
VpaK11BI	GGWCC	1 cut(s)	196
XapI	RAATTY	1 cut(s)	158
XspI	CTAG	2 cut(s)	15, 98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.