pycom11g05640

SAGA-associated factor 11

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
Physical Location & Seq
Forward (+)
4307330 .. 4308384
1055 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGTCGGTTCCAAACGAAGGAAATGATATGTCCTCTTCTTCCGATGCTCAGCTGTCATCTCATGTTTTTGGGGATCTCCTCGATTCGATCATTGTTGATGTTGCATCTGAGTGTCATCGAATAGCGAAGTTGGGTCTTGATCGTAATTTTGAAGAAGAGGAAGAAGAACTAAGGTTGTCAGCCCAAGCACGGGTGAGGTTAGATCGATCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.78

Weight (kDa)

4.46

Isoelectric Point (pI)

76.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 81, 201
AfiI CCNNNNNNNGG 3 cut(s) 17, 189, 190
AgsI TTSAA 1 cut(s) 152
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AlwI GGATC 2 cut(s) 81, 201
AsuHPI GGTGA 1 cut(s) 205
BfaI CTAG 1 cut(s) 211
BlpI GCTNAGC 1 cut(s) 48
BmiI GGNNCC 1 cut(s) 9
BmsI GCATC 2 cut(s) 34, 113
Bpu1102I GCTNAGC 1 cut(s) 48
Bsa29I ATCGAT 1 cut(s) 205
Bsc4I CCNNNNNNNGG 3 cut(s) 17, 189, 190
BseCI ATCGAT 1 cut(s) 205
BseLI CCNNNNNNNGG 3 cut(s) 17, 189, 190
BseMII CTCAG 2 cut(s) 62, 99
BseRI GAGGAG 1 cut(s) 68
BshVI ATCGAT 1 cut(s) 205
BslI CCNNNNNNNGG 3 cut(s) 17, 189, 190
Bsp143I GATC 5 cut(s) 73, 87, 139, 202, 206
Bsp1720I GCTNAGC 1 cut(s) 48
BspCNI CTCAG 2 cut(s) 61, 100
BspDI ATCGAT 1 cut(s) 205
BspLI GGNNCC 1 cut(s) 9
BspPI GGATC 2 cut(s) 81, 201
BssMI GATC 5 cut(s) 73, 87, 139, 202, 206
Bst6I CTCTTC 2 cut(s) 40, 150
BstDEI CTNAG 3 cut(s) 48, 108, 170
BstKTI GATC 5 cut(s) 76, 90, 142, 205, 209
BstMBI GATC 5 cut(s) 73, 87, 139, 202, 206
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
Bsu15I ATCGAT 1 cut(s) 205
BsuTUI ATCGAT 1 cut(s) 205
ClaI ATCGAT 1 cut(s) 205
CviAII CATG 1 cut(s) 62
CviJI RGCY 2 cut(s) 52, 182
CviKI_1 RGCY 2 cut(s) 52, 182
DdeI CTNAG 3 cut(s) 48, 108, 170
DpnI GATC 5 cut(s) 75, 89, 141, 204, 208
DpnII GATC 5 cut(s) 73, 87, 139, 202, 206
Eam1104I CTCTTC 2 cut(s) 40, 150
EarI CTCTTC 2 cut(s) 40, 150
FaeI CATG 1 cut(s) 65
FaiI YATR 2 cut(s) 29, 63
FatI CATG 1 cut(s) 61
FspBI CTAG 1 cut(s) 211
Hin1II CATG 1 cut(s) 65
HinfI GANTC 1 cut(s) 83
HphI GGTGA 1 cut(s) 205
Hpy188I TCNGA 2 cut(s) 43, 109
Hpy188III TCNNGA 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 11
HpyCH4V TGCA 1 cut(s) 104
HpyF3I CTNAG 3 cut(s) 48, 108, 170
Hsp92II CATG 1 cut(s) 65
Kzo9I GATC 5 cut(s) 73, 87, 139, 202, 206
LweI GCATC 2 cut(s) 34, 113
MaeI CTAG 1 cut(s) 211
MalI GATC 5 cut(s) 75, 89, 141, 204, 208
MboI GATC 5 cut(s) 73, 87, 139, 202, 206
MboII GAAGA 6 cut(s) 27, 30, 164, 167, 173, 176
MflI RGATCY 1 cut(s) 73
MluCI AATT 1 cut(s) 145
MnlI CCTC 4 cut(s) 43, 89, 151, 189
MslI CAYNNNNRTG 1 cut(s) 109
MspA1I CMGCKG 1 cut(s) 52
NdeII GATC 5 cut(s) 73, 87, 139, 202, 206
NlaIII CATG 1 cut(s) 65
NlaIV GGNNCC 1 cut(s) 9
PfeI GAWTC 1 cut(s) 83
PspN4I GGNNCC 1 cut(s) 9
PsuI RGATCY 1 cut(s) 73
PvuII CAGCTG 1 cut(s) 52
RseI CAYNNNNRTG 1 cut(s) 109
Sau3AI GATC 5 cut(s) 73, 87, 139, 202, 206
SetI ASST 3 cut(s) 54, 176, 200
SfaNI GCATC 2 cut(s) 34, 113
SgeI CNNG 6 cut(s) 74, 92, 149, 197, 201, 203
SmiMI CAYNNNNRTG 1 cut(s) 109
Sse9I AATT 1 cut(s) 145
SspMI CTAG 1 cut(s) 211
TaqI TCGA 4 cut(s) 81, 86, 118, 205
TasI AATT 1 cut(s) 145
TfiI GAWTC 1 cut(s) 83
XspI CTAG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.