pycom12g06270

Protein of unknown function (DUF1138)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
6367751 .. 6370101
2351 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGAATACGACACCCATTGCATTGTCGTTGATCACCAAAAAGTGGAGAGACGAAGAAGGTTCAAGAATTCCTGTCGTGGGAAAGTTTCTCTCATTATCTCGTCAGAAGTGGAGACAAGAAGAAGGTTCAAGAATTCTTGTTGACAGACCCCATCGTGCGATCTCACCGACTCGGAACTCCTCCTGCTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.28

Weight (kDa)

10.84

Isoelectric Point (pI)

56.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 42
AcsI RAATTY 2 cut(s) 66, 132
AfiI CCNNNNNNNGG 2 cut(s) 42, 77
AgsI TTSAA 2 cut(s) 63, 129
Alw26I GTCTC 2 cut(s) 42, 106
ApoI RAATTY 2 cut(s) 66, 132
AsuHPI GGTGA 2 cut(s) 25, 156
BccI CCATC 1 cut(s) 159
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 2 cut(s) 42, 106
Bsc4I CCNNNNNNNGG 2 cut(s) 42, 77
Bse3DI GCAATG 1 cut(s) 15
BseLI CCNNNNNNNGG 2 cut(s) 42, 77
BseMI GCAATG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 169
BslI CCNNNNNNNGG 2 cut(s) 42, 77
BsmAI GTCTC 2 cut(s) 42, 106
BsmBI CGTCTC 1 cut(s) 42
Bsp143I GATC 2 cut(s) 30, 159
BsrDI GCAATG 1 cut(s) 15
BssMI GATC 2 cut(s) 30, 159
BstKTI GATC 2 cut(s) 33, 162
BstMAI GTCTC 2 cut(s) 42, 106
BstMBI GATC 2 cut(s) 30, 159
DpnI GATC 2 cut(s) 32, 161
DpnII GATC 2 cut(s) 30, 159
EcoRI GAATTC 2 cut(s) 66, 132
Esp3I CGTCTC 1 cut(s) 42
FbaI TGATCA 1 cut(s) 30
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 1 cut(s) 169
HphI GGTGA 2 cut(s) 25, 156
Hpy166II GTNNAC 1 cut(s) 142
Hpy188I TCNGA 2 cut(s) 105, 174
Hpy188III TCNNGA 2 cut(s) 63, 129
Hpy8I GTNNAC 1 cut(s) 142
HpyAV CCTTC 2 cut(s) 50, 116
HpyCH4V TGCA 1 cut(s) 20
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 2 cut(s) 30, 159
LpnPI CCDG 1 cut(s) 84
MalI GATC 2 cut(s) 32, 161
MboI GATC 2 cut(s) 30, 159
MboII GAAGA 2 cut(s) 65, 131
MluCI AATT 2 cut(s) 66, 132
MlyI GAGTC 1 cut(s) 163
MnlI CCTC 1 cut(s) 190
NdeII GATC 2 cut(s) 30, 159
PflMI CCANNNNNTGG 1 cut(s) 42
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
Sau3AI GATC 2 cut(s) 30, 159
SchI GAGTC 1 cut(s) 163
SetI ASST 2 cut(s) 61, 127
SgeI CNNG 9 cut(s) 75, 83, 88, 111, 128, 141, 149, 167, 183
Sse9I AATT 2 cut(s) 66, 132
TasI AATT 2 cut(s) 66, 132
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 42
XapI RAATTY 2 cut(s) 66, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.