pycom12g12250

Ribonuclease P protein subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
14752137 .. 14752658
522 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g12250.3

Sequence Viewer

Length: 312 bp
ATGGCCGGTGAAACAATTGTTGACGATCAACGCCAACGCACTTTGAAGGCATTGGAACGAAGGTTTGAGGCTGCCCAAGTCGAGCTCGATTTACATCAAAAGAAGACTGTCAAGAGATCAAAAACCGATGAAGCTGGAAAGAAATCACAGATTGCAAGTTCTTCGGCTGTTAATTCTTTACCAAATTTAGCGAATCCATCGGCCTCAAGTTCAACTCCATTTAAGAAAGGAGCTTTCACTTTTTCGGGGTATATTAATTCACAAGATCGACGAAAGTGGTCCAACATATGCAAAACTAGTTCAATCTGTTGA

Protein Analysis

104

Amino Acids

11.38

Weight (kDa)

9.88

Isoelectric Point (pI)

46.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 184
AgsI TTSAA 3 cut(s) 46, 213, 303
AhlI ACTAGT 1 cut(s) 296
AluBI AGCT 3 cut(s) 85, 134, 233
AluI AGCT 3 cut(s) 85, 134, 233
Alw21I GWGCWC 1 cut(s) 87
AoxI GGCC 2 cut(s) 3, 201
ApeKI GCWGC 1 cut(s) 71
ApoI RAATTY 1 cut(s) 184
AseI ATTAAT 1 cut(s) 255
AspS9I GGNCC 1 cut(s) 279
AsuHPI GGTGA 1 cut(s) 20
AvaII GGWCC 1 cut(s) 279
BanII GRGCYC 1 cut(s) 87
BbsI GAAGAC 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 87
BbvI GCAGC 1 cut(s) 58
BccI CCATC 1 cut(s) 205
BcgI CGANNNNNNTGC 2 cut(s) 144, 178
BcuI ACTAGT 1 cut(s) 296
BfaI CTAG 1 cut(s) 297
BisI GCNGC 1 cut(s) 72
BlsI GCNGC 1 cut(s) 73
Bme18I GGWCC 1 cut(s) 279
BmgT120I GGNCC 1 cut(s) 279
BpiI GAAGAC 1 cut(s) 110
BpuEI CTTGAG 1 cut(s) 190
BsaBI GATNNNNATC 1 cut(s) 93
Bse118I RCCGGY 1 cut(s) 5
Bse8I GATNNNNATC 1 cut(s) 93
BseJI GATNNNNATC 1 cut(s) 93
BseXI GCAGC 1 cut(s) 58
BshFI GGCC 2 cut(s) 5, 203
BsiHKAI GWGCWC 1 cut(s) 87
BsiSI CCGG 1 cut(s) 6
BsnI GGCC 2 cut(s) 5, 203
Bsp1286I GDGCHC 1 cut(s) 87
Bsp143I GATC 3 cut(s) 25, 116, 265
BspANI GGCC 2 cut(s) 5, 203
BsrFI RCCGGY 1 cut(s) 5
BssAI RCCGGY 1 cut(s) 5
BssMI GATC 3 cut(s) 25, 116, 265
Bst4CI ACNGT 1 cut(s) 109
BstKTI GATC 3 cut(s) 28, 119, 268
BstMBI GATC 3 cut(s) 25, 116, 265
BstV1I GCAGC 1 cut(s) 58
BstV2I GAAGAC 1 cut(s) 110
BsuRI GGCC 2 cut(s) 5, 203
Cfr10I RCCGGY 1 cut(s) 5
Cfr13I GGNCC 1 cut(s) 279
CviJI RGCY 7 cut(s) 5, 71, 85, 134, 167, 203, 233
CviKI_1 RGCY 7 cut(s) 5, 71, 85, 134, 167, 203, 233
DpnI GATC 3 cut(s) 27, 118, 267
DpnII GATC 3 cut(s) 25, 116, 265
EaeI YGGCCR 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 85
Eco24I GRGCYC 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 279
Eco53kI GAGCTC 1 cut(s) 85
EcoICRI GAGCTC 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 87
FaiI YATR 3 cut(s) 252, 287, 289
FauNDI CATATG 1 cut(s) 287
Fnu4HI GCNGC 1 cut(s) 72
FriOI GRGCYC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 72
FspBI CTAG 1 cut(s) 297
GluI GCNGC 1 cut(s) 72
HaeIII GGCC 2 cut(s) 5, 203
HapII CCGG 1 cut(s) 6
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
HinfI GANTC 1 cut(s) 193
HpaII CCGG 1 cut(s) 6
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 1 cut(s) 22
Hpy188III TCNNGA 1 cut(s) 112
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 273
HpyAV CCTTC 2 cut(s) 40, 54
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 155, 291
Kzo9I GATC 3 cut(s) 25, 116, 265
LmnI GCTCC 1 cut(s) 230
LpnPI CCDG 2 cut(s) 19, 120
Lsp1109I GCAGC 1 cut(s) 58
MaeI CTAG 1 cut(s) 297
MalI GATC 3 cut(s) 27, 118, 267
MboI GATC 3 cut(s) 25, 116, 265
MboII GAAGA 2 cut(s) 115, 153
MfeI CAATTG 1 cut(s) 15
MhlI GDGCHC 1 cut(s) 87
MluCI AATT 4 cut(s) 15, 172, 184, 256
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 2 cut(s) 61, 214
MseI TTAA 3 cut(s) 171, 222, 255
MspI CCGG 1 cut(s) 6
MunI CAATTG 1 cut(s) 15
NdeI CATATG 1 cut(s) 287
NdeII GATC 3 cut(s) 25, 116, 265
PfeI GAWTC 1 cut(s) 193
PkrI GCNGC 1 cut(s) 73
PshBI ATTAAT 1 cut(s) 255
Psp124BI GAGCTC 1 cut(s) 87
PspPI GGNCC 1 cut(s) 279
SacI GAGCTC 1 cut(s) 87
SaqAI TTAA 3 cut(s) 171, 222, 255
SatI GCNGC 1 cut(s) 72
Sau3AI GATC 3 cut(s) 25, 116, 265
Sau96I GGNCC 1 cut(s) 279
SduI GDGCHC 1 cut(s) 87
SetI ASST 4 cut(s) 65, 87, 136, 235
SinI GGWCC 1 cut(s) 279
SmlI CTYRAG 1 cut(s) 205
SmoI CTYRAG 1 cut(s) 205
SpeI ACTAGT 1 cut(s) 296
Sse9I AATT 4 cut(s) 15, 172, 184, 256
SspMI CTAG 1 cut(s) 297
SstI GAGCTC 1 cut(s) 87
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 3 cut(s) 81, 87, 268
TasI AATT 4 cut(s) 15, 172, 184, 256
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 3 cut(s) 171, 222, 255
Tru9I TTAA 3 cut(s) 171, 222, 255
TseI GCWGC 1 cut(s) 71
TspDTI ATGAA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 279
VspI ATTAAT 1 cut(s) 255
XapI RAATTY 1 cut(s) 184
XspI CTAG 1 cut(s) 297
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.