pycom13g13220

FR47-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr13
Physical Location & Seq
Forward (+)
9350098 .. 9350337
240 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom13g13220.1

Sequence Viewer

Length: 240 bp
ATGAAATCCGTCTGGAACTTCGCCTCTAGGTTGGGACAAACTGTGAAGGACAGCAAGCTGATTTTAACCGAGCTGGGTTTATGTGATCCTCTTATAAAGCATGTCCCTAAGGATTCCGATATGTCATGTATCGAAGATGTCTGGTACGGCAAGAGTTTGATCAACCACGCTGATGACAAAGATGAACTGCTAGTACAGGGATCACTTGGGAATGTGTTTGTTGATCCTAGAGAGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.91

Weight (kDa)

4.91

Isoelectric Point (pI)

33.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 95
AclWI GGATC 3 cut(s) 80, 208, 218
AfaI GTAC 2 cut(s) 146, 195
AluBI AGCT 2 cut(s) 58, 73
AluI AGCT 2 cut(s) 58, 73
AlwI GGATC 3 cut(s) 80, 208, 218
AxyI CCTNAGG 1 cut(s) 108
BceAI ACGGC 1 cut(s) 163
BclI TGATCA 1 cut(s) 159
BfaI CTAG 4 cut(s) 27, 191, 228, 238
Bse21I CCTNAGG 1 cut(s) 108
BseYI CCCAGC 1 cut(s) 73
BslFI GGGAC 2 cut(s) 48, 89
BsmFI GGGAC 2 cut(s) 48, 89
Bsp143I GATC 4 cut(s) 85, 159, 200, 223
BspPI GGATC 3 cut(s) 80, 208, 218
BssMI GATC 4 cut(s) 85, 159, 200, 223
Bst4CI ACNGT 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 108
BstKTI GATC 4 cut(s) 88, 162, 203, 226
BstMBI GATC 4 cut(s) 85, 159, 200, 223
BstNSI RCATGY 1 cut(s) 104
Bsu36I CCTNAGG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 56
Csp6I GTAC 2 cut(s) 145, 194
CviAII CATG 2 cut(s) 101, 126
CviJI RGCY 2 cut(s) 58, 73
CviKI_1 RGCY 2 cut(s) 58, 73
CviQI GTAC 2 cut(s) 145, 194
DdeI CTNAG 1 cut(s) 108
DpnI GATC 4 cut(s) 87, 161, 202, 225
DpnII GATC 4 cut(s) 85, 159, 200, 223
Eco81I CCTNAGG 1 cut(s) 108
FaeI CATG 2 cut(s) 104, 129
FaiI YATR 5 cut(s) 82, 95, 102, 122, 127
FaqI GGGAC 2 cut(s) 48, 89
FatI CATG 2 cut(s) 100, 125
FbaI TGATCA 1 cut(s) 159
FspBI CTAG 4 cut(s) 27, 191, 228, 238
GsaI CCCAGC 1 cut(s) 77
Hin1II CATG 2 cut(s) 104, 129
HinfI GANTC 1 cut(s) 113
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 43
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 2 cut(s) 104, 129
Ksp22I TGATCA 1 cut(s) 159
Kzo9I GATC 4 cut(s) 85, 159, 200, 223
LpnPI CCDG 3 cut(s) 59, 127, 182
MaeI CTAG 4 cut(s) 27, 191, 228, 238
MalI GATC 4 cut(s) 87, 161, 202, 225
MboI GATC 4 cut(s) 85, 159, 200, 223
MboII GAAGA 1 cut(s) 146
MnlI CCTC 2 cut(s) 34, 99
MseI TTAA 1 cut(s) 65
MslI CAYNNNNRTG 1 cut(s) 171
NdeII GATC 4 cut(s) 85, 159, 200, 223
NlaIII CATG 2 cut(s) 104, 129
NspI RCATGY 1 cut(s) 104
PfeI GAWTC 1 cut(s) 113
PsiI TTATAA 1 cut(s) 95
PspFI CCCAGC 1 cut(s) 73
PsrI GAACNNNNNNTAC 2 cut(s) 177, 209
RsaI GTAC 2 cut(s) 146, 195
RsaNI GTAC 2 cut(s) 145, 194
RseI CAYNNNNRTG 1 cut(s) 171
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 4 cut(s) 85, 159, 200, 223
SetI ASST 3 cut(s) 32, 60, 75
SmiMI CAYNNNNRTG 1 cut(s) 171
SspMI CTAG 4 cut(s) 27, 191, 228, 238
TaaI ACNGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 132
TatI WGTACW 1 cut(s) 193
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
TspDTI ATGAA 2 cut(s) 17, 198
XceI RCATGY 1 cut(s) 104
XspI CTAG 4 cut(s) 27, 191, 228, 238
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.