pycom15g09240

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
5975179 .. 5975541
363 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGGCGGCCTCCAAGCTTGCGATTCTCTCAGTCTTTCTTGCCCTAATTCTCTCCCAGATTCGGGCTGACGCTTCAGTCCCGGCGGAGGAAGACGAGCCAGTGAAGCTCCCTCGATCGGTCGGCCCTGATTCGTCCGCTCTGAAGATCGAGTTGGATCAGCTCAGGGCTAAGATCCACTCCCTAGGTTCGTTTCTATCGTCTTCTGCGAATTCTAGGGTTTATTGGACGAAATTTGTGATTTTTCAAGTGTTAGTGGATTCGATTTTTTCCTTTGGTTTTCTCGCCATACAAACAGATTTTACTAAAGTTAGAGATCCTTTGGTTTTTCAATTGGGAAGTGATTTAATTTCTTTCCATTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.2

Weight (kDa)

6.05

Isoelectric Point (pI)

35.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 361
AasI GACNNNNNNGTC 1 cut(s) 74
AccBSI CCGCTC 1 cut(s) 137
AciI CCGC 3 cut(s) 5, 83, 135
AclWI GGATC 3 cut(s) 162, 166, 308
AcsI RAATTY 2 cut(s) 208, 230
AcuI CTGAAG 2 cut(s) 57, 161
AfiI CCNNNNNNNGG 4 cut(s) 60, 61, 85, 115
AgsI TTSAA 2 cut(s) 245, 329
AjuI GAANNNNNNNTTGG 2 cut(s) 134, 166
AluBI AGCT 3 cut(s) 16, 106, 160
AluI AGCT 3 cut(s) 16, 106, 160
AlwI GGATC 3 cut(s) 162, 166, 308
AoxI GGCC 2 cut(s) 6, 121
ApoI RAATTY 2 cut(s) 208, 230
AspA2I CCTAGG 1 cut(s) 181
AspS9I GGNCC 1 cut(s) 122
AsuC2I CCSGG 1 cut(s) 80
AvrII CCTAGG 1 cut(s) 181
BbsI GAAGAC 2 cut(s) 96, 192
BcnI CCSGG 1 cut(s) 80
BfaI CTAG 2 cut(s) 182, 213
BisI GCNGC 1 cut(s) 6
BlnI CCTAGG 1 cut(s) 181
BlsI GCNGC 1 cut(s) 7
Bme1390I CCNGG 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 122
BmrFI CCNGG 1 cut(s) 80
BpiI GAAGAC 2 cut(s) 96, 192
Bpu10I CCTNAGC 1 cut(s) 161
BpuMI CCSGG 1 cut(s) 80
BsaJI CCNNGG 1 cut(s) 181
Bsc4I CCNNNNNNNGG 4 cut(s) 60, 61, 85, 115
Bse1I ACTGG 1 cut(s) 98
BseDI CCNNGG 1 cut(s) 181
BseLI CCNNNNNNNGG 4 cut(s) 60, 61, 85, 115
BseMII CTCAG 2 cut(s) 42, 175
BseNI ACTGG 1 cut(s) 98
Bsh1285I CGRYCG 2 cut(s) 116, 120
BshFI GGCC 2 cut(s) 8, 123
BsiEI CGRYCG 2 cut(s) 116, 120
BsiSI CCGG 1 cut(s) 80
BslFI GGGAC 1 cut(s) 62
BslI CCNNNNNNNGG 4 cut(s) 60, 61, 85, 115
BsmFI GGGAC 1 cut(s) 62
BsnI GGCC 2 cut(s) 8, 123
Bsp143I GATC 5 cut(s) 113, 144, 154, 171, 313
BspACI CCGC 3 cut(s) 5, 83, 135
BspANI GGCC 2 cut(s) 8, 123
BspCNI CTCAG 2 cut(s) 41, 174
BspPI GGATC 3 cut(s) 162, 166, 308
BsrBI CCGCTC 1 cut(s) 137
BsrI ACTGG 1 cut(s) 98
BssECI CCNNGG 1 cut(s) 181
BssMI GATC 5 cut(s) 113, 144, 154, 171, 313
BssT1I CCWWGG 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 18
BstDEI CTNAG 3 cut(s) 28, 161, 168
BstKTI GATC 5 cut(s) 116, 147, 157, 174, 316
BstMBI GATC 5 cut(s) 113, 144, 154, 171, 313
BstMCI CGRYCG 2 cut(s) 116, 120
BstMWI GCNNNNNNNGC 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 78
BstV2I GAAGAC 2 cut(s) 96, 192
BstX2I RGATCY 2 cut(s) 171, 313
BstYI RGATCY 2 cut(s) 171, 313
BsuRI GGCC 2 cut(s) 8, 123
BtsIMutI CAGTG 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 18
Cfr13I GGNCC 1 cut(s) 122
CseI GACGC 1 cut(s) 77
CviJI RGCY 8 cut(s) 8, 16, 65, 97, 106, 123, 160, 167
CviKI_1 RGCY 8 cut(s) 8, 16, 65, 97, 106, 123, 160, 167
DdeI CTNAG 3 cut(s) 28, 161, 168
DpnI GATC 5 cut(s) 115, 146, 156, 173, 315
DpnII GATC 5 cut(s) 113, 144, 154, 171, 313
DrdI GACNNNNNNGTC 1 cut(s) 74
DseDI GACNNNNNNGTC 1 cut(s) 74
EciI GGCGGA 1 cut(s) 98
Eco130I CCWWGG 1 cut(s) 181
Eco57I CTGAAG 2 cut(s) 57, 161
EcoRI GAATTC 1 cut(s) 208
EcoT14I CCWWGG 1 cut(s) 181
ErhI CCWWGG 1 cut(s) 181
FaiI YATR 2 cut(s) 287, 361
FaqI GGGAC 1 cut(s) 62
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
FspBI CTAG 2 cut(s) 182, 213
GluI GCNGC 1 cut(s) 6
HaeIII GGCC 2 cut(s) 8, 123
HapII CCGG 1 cut(s) 80
HgaI GACGC 1 cut(s) 77
HindIII AAGCTT 1 cut(s) 14
HinfI GANTC 4 cut(s) 22, 58, 128, 257
HpaII CCGG 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 103
HpyF3I CTNAG 3 cut(s) 28, 161, 168
Kzo9I GATC 5 cut(s) 113, 144, 154, 171, 313
LmnI GCTCC 1 cut(s) 111
LpnPI CCDG 5 cut(s) 68, 93, 111, 138, 148
MaeI CTAG 2 cut(s) 182, 213
MalI GATC 5 cut(s) 115, 146, 156, 173, 315
MbiI CCGCTC 1 cut(s) 137
MboI GATC 5 cut(s) 113, 144, 154, 171, 313
MboII GAAGA 3 cut(s) 101, 154, 192
MfeI CAATTG 1 cut(s) 329
MflI RGATCY 2 cut(s) 171, 313
MluCI AATT 5 cut(s) 45, 208, 230, 329, 345
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 3 cut(s) 19, 79, 120
MseI TTAA 1 cut(s) 344
MspI CCGG 1 cut(s) 80
MspR9I CCNGG 1 cut(s) 80
MunI CAATTG 1 cut(s) 329
MwoI GCNNNNNNNGC 1 cut(s) 103
NciI CCSGG 1 cut(s) 80
NdeII GATC 5 cut(s) 113, 144, 154, 171, 313
PcsI WCGNNNNNNNCGW 2 cut(s) 194, 203
PfeI GAWTC 4 cut(s) 22, 58, 128, 257
PkrI GCNGC 1 cut(s) 7
Ple19I CGATCG 1 cut(s) 116
PsiI TTATAA 1 cut(s) 361
PspPI GGNCC 1 cut(s) 122
PsuI RGATCY 2 cut(s) 171, 313
PvuI CGATCG 1 cut(s) 116
SaqAI TTAA 1 cut(s) 344
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 5 cut(s) 113, 144, 154, 171, 313
Sau96I GGNCC 1 cut(s) 122
ScrFI CCNGG 1 cut(s) 80
SetI ASST 4 cut(s) 18, 108, 162, 187
Sse9I AATT 5 cut(s) 45, 208, 230, 329, 345
SsiI CCGC 3 cut(s) 5, 83, 135
SspMI CTAG 2 cut(s) 182, 213
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 181
TaqI TCGA 3 cut(s) 112, 147, 260
TaqII GACCGA 1 cut(s) 106
TasI AATT 5 cut(s) 45, 208, 230, 329, 345
TauI GCSGC 1 cut(s) 8
TfiI GAWTC 4 cut(s) 22, 58, 128, 257
Tru1I TTAA 1 cut(s) 344
Tru9I TTAA 1 cut(s) 344
TscAI CASTG 1 cut(s) 105
TspRI CASTG 1 cut(s) 105
XapI RAATTY 2 cut(s) 208, 230
XmaJI CCTAGG 1 cut(s) 181
XspI CTAG 2 cut(s) 182, 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.