RchiOBHm_Chr4g0442511

Carrier of the growing fatty acid chain in fatty acid biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
64059524 .. 64059809
286 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 183 bp
ATGAAGGTGACTCCTGATGCACATTTCCAAAAAGATTTGGGCTTAGATAGCTTGGATAATGTGGAGATTGTAATGGCTCTAGAAGAAGAGTTCAAGCTTGAGATTCCTGACAAGGAAGCTGATAAGATTGATTCTACAAATCTGGATATTGAGTACATCTATAACCATCCAATGGCTTGGTAA

Protein Analysis

60

Amino Acids

6.98

Weight (kDa)

4.19

Isoelectric Point (pI)

20.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP-binding PF00550 3 - 40 2.8e-08 Phosphopantetheine attachment site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 172
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 172
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 3 cut(s) 51, 97, 119
AluI AGCT 3 cut(s) 51, 97, 119
AsuHPI GGTGA 1 cut(s) 19
BccI CCATC 1 cut(s) 174
BfaI CTAG 1 cut(s) 80
BmsI GCATC 1 cut(s) 7
BpuEI CTTGAG 1 cut(s) 119
Bsc4I CCNNNNNNNGG 1 cut(s) 172
BseGI GGATG 1 cut(s) 166
BseLI CCNNNNNNNGG 1 cut(s) 172
BslI CCNNNNNNNGG 1 cut(s) 172
Bst6I CTCTTC 1 cut(s) 81
BstDEI CTNAG 1 cut(s) 43
BstF5I GGATG 1 cut(s) 166
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstXI CCANNNNNNTGG 1 cut(s) 177
BtsCI GGATG 1 cut(s) 166
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 6 cut(s) 42, 51, 77, 97, 119, 176
CviKI_1 RGCY 6 cut(s) 42, 51, 77, 97, 119, 176
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 43
Eam1104I CTCTTC 1 cut(s) 81
EarI CTCTTC 1 cut(s) 81
FaiI YATR 1 cut(s) 162
FokI GGATG 1 cut(s) 153
FspBI CTAG 1 cut(s) 80
HindIII AAGCTT 1 cut(s) 95
HinfI GANTC 3 cut(s) 10, 103, 131
HphI GGTGA 1 cut(s) 19
Hpy188III TCNNGA 4 cut(s) 14, 80, 107, 143
HpyCH4V TGCA 1 cut(s) 20
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 43
LpnPI CCDG 3 cut(s) 27, 120, 128
LweI GCATC 1 cut(s) 7
MaeI CTAG 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 7
MboII GAAGA 2 cut(s) 95, 98
MlyI GAGTC 1 cut(s) 4
MwoI GCNNNNNNNGC 1 cut(s) 48
NmuCI GTSAC 1 cut(s) 7
PfeI GAWTC 2 cut(s) 103, 131
PflMI CCANNNNNTGG 1 cut(s) 172
PleI GAGTC 1 cut(s) 4
PpsI GAGTC 1 cut(s) 4
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
SchI GAGTC 1 cut(s) 4
SetI ASST 4 cut(s) 9, 53, 99, 121
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 8 cut(s) 26, 64, 92, 106, 110, 119, 124, 155
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
SspMI CTAG 1 cut(s) 80
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 2 cut(s) 103, 131
TseFI GTSAC 1 cut(s) 7
Tsp45I GTSAC 1 cut(s) 7
TspDTI ATGAA 1 cut(s) 17
Van91I CCANNNNNTGG 1 cut(s) 172
XbaI TCTAGA 1 cut(s) 79
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.