Rmu_sc0033183.1_g000001

Carrier of the growing fatty acid chain in fatty acid biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033183.1
Physical Location & Seq
Forward (+)
1 .. 153
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033183.1_g000001.1.cds

Sequence Viewer

Length: 153 bp
aaagatttgggcttagatagcttggataatgtggagattgtaatggctctagaagaagagttcaagcttgagattcctgacaaggaagctgataagattgattctacaaatctggccattgagtacatctctaaccatccaatggcttcgtaa

Protein Analysis

50

Amino Acids

5.61

Weight (kDa)

4.08

Isoelectric Point (pI)

31.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 114
AfaI GTAC 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 142
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 3 cut(s) 21, 67, 89
AluI AGCT 3 cut(s) 21, 67, 89
AoxI GGCC 1 cut(s) 114
BalI TGGCCA 1 cut(s) 116
BccI CCATC 1 cut(s) 144
BfaI CTAG 1 cut(s) 50
BplI GAGNNNNNCTC 2 cut(s) 113, 145
BpuEI CTTGAG 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 142
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 142
BsnI GGCC 1 cut(s) 116
BspANI GGCC 1 cut(s) 116
Bst6I CTCTTC 1 cut(s) 51
BstDEI CTNAG 1 cut(s) 13
BstF5I GGATG 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 18
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 1 cut(s) 136
Csp6I GTAC 1 cut(s) 124
CviJI RGCY 7 cut(s) 12, 21, 47, 67, 89, 116, 146
CviKI_1 RGCY 7 cut(s) 12, 21, 47, 67, 89, 116, 146
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
FokI GGATG 1 cut(s) 123
FspBI CTAG 1 cut(s) 50
FspEI CC 9 cut(s) 8, 17, 29, 68, 90, 98, 128, 130, 149
HaeIII GGCC 1 cut(s) 116
HindIII AAGCTT 1 cut(s) 65
HinfI GANTC 2 cut(s) 73, 101
Hpy188III TCNNGA 2 cut(s) 50, 77
HpyF10VI GCNNNNNNNGC 1 cut(s) 18
HpyF3I CTNAG 1 cut(s) 13
LpnPI CCDG 2 cut(s) 90, 98
MaeI CTAG 1 cut(s) 50
MboII GAAGA 2 cut(s) 65, 68
MlsI TGGCCA 1 cut(s) 116
MluNI TGGCCA 1 cut(s) 116
Mox20I TGGCCA 1 cut(s) 116
MscI TGGCCA 1 cut(s) 116
Msp20I TGGCCA 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 18
PfeI GAWTC 2 cut(s) 73, 101
PflMI CCANNNNNTGG 1 cut(s) 142
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SetI ASST 3 cut(s) 23, 69, 91
SgeI CNNG 7 cut(s) 34, 62, 76, 80, 89, 94, 125
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SspMI CTAG 1 cut(s) 50
TatI WGTACW 1 cut(s) 123
TfiI GAWTC 2 cut(s) 73, 101
Van91I CCANNNNNTGG 1 cut(s) 142
XbaI TCTAGA 1 cut(s) 49
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.