Rroxscaffold_4G00310120

Carrier of the growing fatty acid chain in fatty acid biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
32026345 .. 32038343
11999 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00310120.1

Sequence Viewer

Length: 153 bp
ATGGCATTTGGGCTCGATAGCTTGGATAATGTGGAGATTGTAATGGCTCTAGAAGAAGAGTTCAAACTTGAGATTCCCGATAAGGAAGCCGATAAGATTGATTCTGCAAATCTGGCCATTGATTACATCCATAACCATCCAATGGCTTCATAA

Protein Analysis

50

Amino Acids

5.6

Weight (kDa)

4.12

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP-binding PF00550 2 - 40 1e-05 Phosphopantetheine attachment site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 142
AcoI YGGCCR 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 142
AgsI TTSAA 1 cut(s) 64
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
AoxI GGCC 1 cut(s) 114
BalI TGGCCA 1 cut(s) 116
BanII GRGCYC 1 cut(s) 15
BccI CCATC 1 cut(s) 144
BfaI CTAG 1 cut(s) 50
BpuEI CTTGAG 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 142
BseGI GGATG 2 cut(s) 126, 136
BseLI CCNNNNNNNGG 1 cut(s) 142
BshFI GGCC 1 cut(s) 116
BslI CCNNNNNNNGG 1 cut(s) 142
BsnI GGCC 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 15
BspANI GGCC 1 cut(s) 116
Bst6I CTCTTC 1 cut(s) 51
BstF5I GGATG 2 cut(s) 126, 136
BstMWI GCNNNNNNNGC 1 cut(s) 113
BsuRI GGCC 1 cut(s) 116
BtsCI GGATG 2 cut(s) 126, 136
CviJI RGCY 6 cut(s) 13, 21, 47, 89, 116, 146
CviKI_1 RGCY 6 cut(s) 13, 21, 47, 89, 116, 146
EaeI YGGCCR 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco24I GRGCYC 1 cut(s) 15
EcoT38I GRGCYC 1 cut(s) 15
FaiI YATR 2 cut(s) 132, 151
FokI GGATG 2 cut(s) 113, 123
FriOI GRGCYC 1 cut(s) 15
FspBI CTAG 1 cut(s) 50
HaeIII GGCC 1 cut(s) 116
HinfI GANTC 2 cut(s) 73, 101
Hpy188III TCNNGA 2 cut(s) 50, 77
HpyCH4V TGCA 1 cut(s) 107
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
LpnPI CCDG 1 cut(s) 98
MaeI CTAG 1 cut(s) 50
MboII GAAGA 2 cut(s) 65, 68
MhlI GDGCHC 1 cut(s) 15
MlsI TGGCCA 1 cut(s) 116
MluNI TGGCCA 1 cut(s) 116
Mox20I TGGCCA 1 cut(s) 116
MscI TGGCCA 1 cut(s) 116
Msp20I TGGCCA 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 113
PfeI GAWTC 2 cut(s) 73, 101
PflMI CCANNNNNTGG 1 cut(s) 142
SduI GDGCHC 1 cut(s) 15
SetI ASST 1 cut(s) 23
SgeI CNNG 6 cut(s) 26, 34, 62, 80, 89, 125
SmlI CTYRAG 1 cut(s) 68
SmoI CTYRAG 1 cut(s) 68
SspMI CTAG 1 cut(s) 50
TaqI TCGA 1 cut(s) 15
TfiI GAWTC 2 cut(s) 73, 101
TspDTI ATGAA 1 cut(s) 138
Van91I CCANNNNNTGG 1 cut(s) 142
XbaI TCTAGA 1 cut(s) 49
XspI CTAG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.