RLG00000028930

Carrier of the growing fatty acid chain in fatty acid biosynthesis

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Reverse (-)
30276254 .. 30279610
3357 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000028930

Sequence Viewer

Length: 306 bp
ATGGATTCTAACAATTTGGTTCCTAACATAACCGGACCCAAATGGGGCCCACCTTCTCTCCGGTGGATGTCTTCGCACGACGATCATCTCACCAAAAACGAGGTCAACGACAGAGTCAATCCTTCCATGGTGACTCCTGATGTACATTTCCAAAAAAATTTGGGCTTAGATAGCTTGGATAATGTGGAGATTTTAATGGCTCTAGAAGAAAAGTTCAAGCTTGAGATTCTTGACAAGGAAGCCTATAAGATTGATTCTGCAAATCTGGCCATTGAGTACATCTATAACCATCCAATGGCTTCGTAA

Protein Analysis

102

Amino Acids

11.52

Weight (kDa)

4.85

Isoelectric Point (pI)

50.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP-binding PF00550 39 - 88 1.4e-06 Phosphopantetheine attachment site
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 295
AcoI YGGCCR 1 cut(s) 267
AcsI RAATTY 1 cut(s) 157
AfaI GTAC 2 cut(s) 144, 278
AfiI CCNNNNNNNGG 2 cut(s) 44, 295
AgsI TTSAA 1 cut(s) 217
AluBI AGCT 2 cut(s) 174, 220
AluI AGCT 2 cut(s) 174, 220
AoxI GGCC 2 cut(s) 46, 267
ApaI GGGCCC 1 cut(s) 50
ApoI RAATTY 1 cut(s) 157
ArsI GACNNNNNNTTYG 2 cut(s) 87, 119
AspS9I GGNCC 3 cut(s) 35, 46, 47
AsuHPI GGTGA 2 cut(s) 82, 142
AvaII GGWCC 1 cut(s) 35
BaeGI GKGCMC 1 cut(s) 50
BalI TGGCCA 1 cut(s) 269
BanII GRGCYC 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 63
BccI CCATC 1 cut(s) 297
BfaI CTAG 1 cut(s) 203
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 3 cut(s) 35, 46, 47
BmiI GGNNCC 4 cut(s) 21, 37, 47, 48
BpiI GAAGAC 1 cut(s) 63
BpuEI CTTGAG 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 126
BsaWI WCCGGW 2 cut(s) 32, 60
BsaXI ACNNNNNCTCC 2 cut(s) 42, 72
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 295
BseDI CCNNGG 1 cut(s) 126
BseGI GGATG 2 cut(s) 72, 289
BseLI CCNNNNNNNGG 2 cut(s) 44, 295
BseSI GKGCMC 1 cut(s) 50
BshFI GGCC 2 cut(s) 48, 269
BsiSI CCGG 2 cut(s) 33, 61
BslI CCNNNNNNNGG 2 cut(s) 44, 295
BsnI GGCC 2 cut(s) 48, 269
Bsp120I GGGCCC 1 cut(s) 46
Bsp1286I GDGCHC 1 cut(s) 50
Bsp1407I TGTACA 1 cut(s) 142
Bsp143I GATC 1 cut(s) 82
Bsp19I CCATGG 1 cut(s) 126
BspANI GGCC 2 cut(s) 48, 269
BspLI GGNNCC 4 cut(s) 21, 37, 47, 48
BsrGI TGTACA 1 cut(s) 142
BssECI CCNNGG 1 cut(s) 126
BssMI GATC 1 cut(s) 82
BssT1I CCWWGG 1 cut(s) 126
BstAUI TGTACA 1 cut(s) 142
BstDEI CTNAG 1 cut(s) 166
BstDSI CCRYGG 1 cut(s) 126
BstF5I GGATG 2 cut(s) 72, 289
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstMWI GCNNNNNNNGC 2 cut(s) 171, 266
BstSLI GKGCMC 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 63
BsuRI GGCC 2 cut(s) 48, 269
BtgI CCRYGG 1 cut(s) 126
BtsCI GGATG 2 cut(s) 72, 289
Cfr13I GGNCC 3 cut(s) 35, 46, 47
Csp6I GTAC 2 cut(s) 143, 277
CviAII CATG 1 cut(s) 127
CviJI RGCY 8 cut(s) 48, 165, 174, 200, 220, 242, 269, 299
CviKI_1 RGCY 8 cut(s) 48, 165, 174, 200, 220, 242, 269, 299
CviQI GTAC 2 cut(s) 143, 277
DdeI CTNAG 1 cut(s) 166
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 126
Eco24I GRGCYC 1 cut(s) 50
Eco47I GGWCC 1 cut(s) 35
EcoO109I RGGNCCY 1 cut(s) 46
EcoT14I CCWWGG 1 cut(s) 126
EcoT38I GRGCYC 1 cut(s) 50
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 1 cut(s) 130
FaiI YATR 4 cut(s) 29, 128, 246, 285
FatI CATG 1 cut(s) 126
FokI GGATG 2 cut(s) 79, 276
FriOI GRGCYC 1 cut(s) 50
FspBI CTAG 1 cut(s) 203
HaeIII GGCC 2 cut(s) 48, 269
HapII CCGG 2 cut(s) 33, 61
Hin1II CATG 1 cut(s) 130
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 1 cut(s) 218
HinfI GANTC 5 cut(s) 5, 114, 133, 226, 254
HpaII CCGG 2 cut(s) 33, 61
HphI GGTGA 2 cut(s) 82, 142
Hpy166II GTNNAC 1 cut(s) 106
Hpy188III TCNNGA 3 cut(s) 137, 203, 230
Hpy8I GTNNAC 1 cut(s) 106
Hpy99I CGWCG 1 cut(s) 83
HpyAV CCTTC 2 cut(s) 63, 132
HpyCH4V TGCA 1 cut(s) 260
HpyF10VI GCNNNNNNNGC 2 cut(s) 171, 266
HpyF3I CTNAG 1 cut(s) 166
Hsp92II CATG 1 cut(s) 130
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 4 cut(s) 46, 74, 150, 251
MaeI CTAG 1 cut(s) 203
MaeIII GTNAC 1 cut(s) 130
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 2 cut(s) 63, 218
MhlI GDGCHC 1 cut(s) 50
MlsI TGGCCA 1 cut(s) 269
MluCI AATT 2 cut(s) 13, 157
MluNI TGGCCA 1 cut(s) 269
MlyI GAGTC 2 cut(s) 123, 127
MnlI CCTC 1 cut(s) 94
Mox20I TGGCCA 1 cut(s) 269
MscI TGGCCA 1 cut(s) 269
MseI TTAA 1 cut(s) 194
Msp20I TGGCCA 1 cut(s) 269
MspI CCGG 2 cut(s) 33, 61
MwoI GCNNNNNNNGC 2 cut(s) 171, 266
NcoI CCATGG 1 cut(s) 126
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 4 cut(s) 21, 37, 47, 48
NmuCI GTSAC 1 cut(s) 130
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PfeI GAWTC 3 cut(s) 5, 226, 254
PflFI GACNNNGTC 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 295
PleI GAGTC 2 cut(s) 122, 127
PpsI GAGTC 2 cut(s) 122, 127
PspN4I GGNNCC 4 cut(s) 21, 37, 47, 48
PspOMI GGGCCC 1 cut(s) 46
PspPI GGNCC 3 cut(s) 35, 46, 47
PsyI GACNNNGTC 1 cut(s) 113
RsaI GTAC 2 cut(s) 144, 278
RsaNI GTAC 2 cut(s) 143, 277
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 1 cut(s) 82
Sau96I GGNCC 3 cut(s) 35, 46, 47
SchI GAGTC 2 cut(s) 123, 127
SduI GDGCHC 1 cut(s) 50
SetI ASST 4 cut(s) 55, 105, 176, 222
SinI GGWCC 1 cut(s) 35
SmlI CTYRAG 1 cut(s) 221
SmoI CTYRAG 1 cut(s) 221
Sse9I AATT 2 cut(s) 13, 157
SspMI CTAG 1 cut(s) 203
StyI CCWWGG 1 cut(s) 126
TasI AATT 2 cut(s) 13, 157
TatI WGTACW 2 cut(s) 142, 276
TfiI GAWTC 3 cut(s) 5, 226, 254
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TseFI GTSAC 1 cut(s) 130
Tsp45I GTSAC 1 cut(s) 130
Tth111I GACNNNGTC 1 cut(s) 113
Van91I CCANNNNNTGG 1 cut(s) 295
VpaK11BI GGWCC 1 cut(s) 35
XapI RAATTY 1 cut(s) 157
XbaI TCTAGA 1 cut(s) 202
XspI CTAG 1 cut(s) 203
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.