RchiOBHm_Chr3g0478911

V-type proton ATPase subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
24604125 .. 24605997
1873 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGCTATCAGCCCTGAGATCATCGAGTCTGTCAAATAGCTGTTGGAAGAGTAATTGGTTCACACAAGAGATGAGCTATATGATACTTGCTTTAATAGTGAGTACCAGGCCAAAACTCGAAGGAACTGTTGCAGATGGAGAAGCCTCAAATTCAGAGAGTAGATTGATTTGGTGGTTTCGTGATAGATTGAAGAAGGCCTCGGGAGTTTTCTAG

Protein Analysis

70

Amino Acids

7.98

Weight (kDa)

9.51

Isoelectric Point (pI)

50.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AfaI GTAC 1 cut(s) 103
AgsI TTSAA 1 cut(s) 190
AjnI CCWGG 1 cut(s) 104
AluBI AGCT 2 cut(s) 39, 75
AluI AGCT 2 cut(s) 39, 75
Ama87I CYCGRG 1 cut(s) 199
AoxI GGCC 2 cut(s) 107, 195
ApoI RAATTY 1 cut(s) 148
AvaI CYCGRG 1 cut(s) 199
BccI CCATC 1 cut(s) 128
BciT130I CCWGG 1 cut(s) 106
BfaI CTAG 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 106
BmeT110I CYCGRG 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 106
BsaJI CCNNGG 1 cut(s) 198
BseBI CCWGG 1 cut(s) 106
BseDI CCNNGG 1 cut(s) 198
BseMII CTCAG 1 cut(s) 5
BshFI GGCC 2 cut(s) 109, 197
BsiHKCI CYCGRG 1 cut(s) 199
BsnI GGCC 2 cut(s) 109, 197
BsoBI CYCGRG 1 cut(s) 199
Bsp143I GATC 1 cut(s) 17
BspANI GGCC 2 cut(s) 109, 197
BspCNI CTCAG 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 106
Bst4CI ACNGT 1 cut(s) 127
Bst6I CTCTTC 1 cut(s) 41
BstDEI CTNAG 1 cut(s) 14
BstKTI GATC 1 cut(s) 20
BstMBI GATC 1 cut(s) 17
BstNI CCWGG 1 cut(s) 106
BstSCI CCNGG 1 cut(s) 104
BsuRI GGCC 2 cut(s) 109, 197
Csp6I GTAC 1 cut(s) 102
CviJI RGCY 6 cut(s) 11, 39, 75, 109, 143, 197
CviKI_1 RGCY 6 cut(s) 11, 39, 75, 109, 143, 197
CviQI GTAC 1 cut(s) 102
DdeI CTNAG 1 cut(s) 14
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
Eam1104I CTCTTC 1 cut(s) 41
EarI CTCTTC 1 cut(s) 41
Eco147I AGGCCT 1 cut(s) 197
Eco88I CYCGRG 1 cut(s) 199
EcoRII CCWGG 1 cut(s) 104
FaiI YATR 2 cut(s) 78, 80
FspBI CTAG 1 cut(s) 211
HaeIII GGCC 2 cut(s) 109, 197
HinfI GANTC 1 cut(s) 25
Hpy166II GTNNAC 1 cut(s) 60
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 2 cut(s) 179, 201
Hpy8I GTNNAC 1 cut(s) 60
HpyAV CCTTC 2 cut(s) 113, 187
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 14
Kzo9I GATC 1 cut(s) 17
LpnPI CCDG 3 cut(s) 26, 91, 118
MaeI CTAG 1 cut(s) 211
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MboII GAAGA 2 cut(s) 58, 202
MluCI AATT 2 cut(s) 52, 148
MlyI GAGTC 1 cut(s) 34
MmeI TCCRAC 1 cut(s) 23
MnlI CCTC 2 cut(s) 154, 208
MseI TTAA 1 cut(s) 92
MspR9I CCNGG 1 cut(s) 106
MvaI CCWGG 1 cut(s) 106
NdeII GATC 1 cut(s) 17
PceI AGGCCT 1 cut(s) 197
PleI GAGTC 1 cut(s) 33
PpsI GAGTC 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 104
PspGI CCWGG 1 cut(s) 104
RsaI GTAC 1 cut(s) 103
RsaNI GTAC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 92
Sau3AI GATC 1 cut(s) 17
SchI GAGTC 1 cut(s) 34
ScrFI CCNGG 1 cut(s) 106
SetI ASST 2 cut(s) 41, 77
SgeI CNNG 8 cut(s) 25, 36, 77, 98, 117, 118, 128, 191
Sse9I AATT 2 cut(s) 52, 148
SseBI AGGCCT 1 cut(s) 197
SspMI CTAG 1 cut(s) 211
StuI AGGCCT 1 cut(s) 197
StyD4I CCNGG 1 cut(s) 104
TaaI ACNGT 1 cut(s) 127
TaqI TCGA 2 cut(s) 23, 117
TasI AATT 2 cut(s) 52, 148
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
XapI RAATTY 1 cut(s) 148
XspI CTAG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.