Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002758.1

Orthogroup ID

OG0007551

Physical Location & Seq

Genomic Coordinates Forward (+)

19388 .. 19969

Gene Structure 582 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002758.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 420 bp

atggattgggcgggagttttcaggaagatttggatatctctgggaggtgggcttgggtttgttttggaagaggtatgtgccaagattgtgatcgagtttaggagacaggctttaggagcaaaagaggtatgtgttttgttggttattgcagttctgctaagtcaagattggattctttttttggtttttttccttttgtatggattgactgctggtgtcggttatttcctggaggcctgcggcctagtgagggagggagatctcttcattgtgagagttggaatgaggagtgtcgagtttaaggttattgagactgatcattctgagtactgtgctgtagctccagacattgaaatatttccaatagggtttactaaagtggctacagatgagaattctaaagctggatcaaatgtctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005654 GO:0005730 GO:0005737 GO:0005794 GO:0005829 GO:0005886 GO:0008150 GO:0009893 GO:0009894 GO:0009896 GO:0010035 GO:0010038 GO:0010604 GO:0012505 GO:0016020 GO:0019222 GO:0031974 GO:0031981 GO:0042176 GO:0042221 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0045732 GO:0046686 GO:0048518 GO:0050789 GO:0050896 GO:0051171 GO:0051173 GO:0051246 GO:0051247 GO:0060255 GO:0065007 GO:0070013 GO:0071944 GO:0080090

KEGG Pathways

Metabolic & Signaling

ko04141 ko05134 map04141 map05134

Pfam Domains

Protein Families

AAA CDC48_2 CDC48_N Vps4_C

Protein Analysis

139

Amino Acids

15.34

Weight (kDa)

4.84

Isoelectric Point (pI)

34.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007551)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr3g0478911
rosa_laevigata	RLG00000026511
rosa_multiflora	Rmu_sc0000389.1_g000007 Rmu_sc0000928.1_g000027 Rmu_sc0002095.1_g000017 Rmu_sc0002638.1_g000012 Rmu_sc0002758.1_g000004 Rmu_sc0009858.1_g000003
rosa_roxburghii	Rroxscaffold_1G00073970
rosa_rugosa	Rorug04G0136700 Rorug04G0136700 Rorug04G0136800
rosa_samantha	Rh1AG191900 Rh1CG176800 Rh2BG338400 Rh2CG545100 Rh3BG252700 Rh6AG125800 Rh7AG444700 Rh7CG089300
rosa_wichuraiana	Rw1G012980 Rw1G015750 Rw4G030500 Rw5G014980 Rw7G032850

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	11, 240
AclWI	GGATC	1 cut(s)	415
AcsI	RAATTY	1 cut(s)	394
AfaI	GTAC	1 cut(s)	329
AfiI	CCNNNNNNNGG	1 cut(s)	250
AgsI	TTSAA	1 cut(s)	353
AjnI	CCWGG	1 cut(s)	228
AluBI	AGCT	2 cut(s)	341, 404
AluI	AGCT	2 cut(s)	341, 404
Alw26I	GTCTC	2 cut(s)	97, 305
AlwI	GGATC	1 cut(s)	415
AoxI	GGCC	2 cut(s)	234, 241
ApoI	RAATTY	1 cut(s)	394
Asp700I	GAANNNNTTC	1 cut(s)	357
BciT130I	CCWGG	1 cut(s)	230
BclI	TGATCA	1 cut(s)	316
BcoDI	GTCTC	2 cut(s)	97, 305
BfaI	CTAG	2 cut(s)	245, 418
BfmI	CTRYAG	2 cut(s)	336, 384
BglII	AGATCT	1 cut(s)	259
BisI	GCNGC	1 cut(s)	241
BlsI	GCNGC	1 cut(s)	242
BmcAI	AGTACT	1 cut(s)	329
Bme1390I	CCNGG	1 cut(s)	230
BmrFI	CCNGG	1 cut(s)	230
BpmI	CTGGAG	2 cut(s)	251, 327
BsaBI	GATNNNNATC	1 cut(s)	89
Bsc4I	CCNNNNNNNGG	1 cut(s)	250
Bse8I	GATNNNNATC	1 cut(s)	89
BseBI	CCWGG	1 cut(s)	230
BseJI	GATNNNNATC	1 cut(s)	89
BseLI	CCNNNNNNNGG	1 cut(s)	250
BseMII	CTCAG	1 cut(s)	315
BseRI	GAGGAG	1 cut(s)	301
BshFI	GGCC	2 cut(s)	236, 243
BslI	CCNNNNNNNGG	1 cut(s)	250
BsmAI	GTCTC	2 cut(s)	97, 305
BsnI	GGCC	2 cut(s)	236, 243
Bsp143I	GATC	4 cut(s)	90, 259, 316, 407
BspACI	CCGC	2 cut(s)	11, 240
BspANI	GGCC	2 cut(s)	236, 243
BspCNI	CTCAG	1 cut(s)	316
BspPI	GGATC	1 cut(s)	415
BssMI	GATC	4 cut(s)	90, 259, 316, 407
Bst2UI	CCWGG	1 cut(s)	230
Bst4CI	ACNGT	1 cut(s)	332
Bst6I	CTCTTC	2 cut(s)	63, 269
BstC8I	GCNNGC	1 cut(s)	238
BstDEI	CTNAG	2 cut(s)	158, 324
BstKTI	GATC	4 cut(s)	93, 262, 319, 410
BstMAI	GTCTC	2 cut(s)	97, 305
BstMBI	GATC	4 cut(s)	90, 259, 316, 407
BstMWI	GCNNNNNNNGC	1 cut(s)	116
BstNI	CCWGG	1 cut(s)	230
BstSCI	CCNGG	1 cut(s)	228
BstSFI	CTRYAG	2 cut(s)	336, 384
BstX2I	RGATCY	1 cut(s)	259
BstYI	RGATCY	1 cut(s)	259
BsuRI	GGCC	2 cut(s)	236, 243
Cac8I	GCNNGC	1 cut(s)	238
Csp6I	GTAC	1 cut(s)	328
CviJI	RGCY	7 cut(s)	52, 110, 236, 243, 341, 383, 404
CviKI_1	RGCY	7 cut(s)	52, 110, 236, 243, 341, 383, 404
CviQI	GTAC	1 cut(s)	328
DdeI	CTNAG	2 cut(s)	158, 324
DpnI	GATC	4 cut(s)	92, 261, 318, 409
DpnII	GATC	4 cut(s)	90, 259, 316, 407
Eam1104I	CTCTTC	2 cut(s)	63, 269
EarI	CTCTTC	2 cut(s)	63, 269
Eco147I	AGGCCT	1 cut(s)	236
Eco32I	GATATC	1 cut(s)	36
EcoRI	GAATTC	1 cut(s)	394
EcoRII	CCWGG	1 cut(s)	228
EcoRV	GATATC	1 cut(s)	36
FaiI	YATR	3 cut(s)	76, 130, 201
FauI	CCCGC	1 cut(s)	4
FbaI	TGATCA	1 cut(s)	316
Fnu4HI	GCNGC	1 cut(s)	241
Fsp4HI	GCNGC	1 cut(s)	241
FspBI	CTAG	2 cut(s)	245, 418
GluI	GCNGC	1 cut(s)	241
GsuI	CTGGAG	2 cut(s)	251, 327
HaeIII	GGCC	2 cut(s)	236, 243
HinfI	GANTC	1 cut(s)	172
Hpy166II	GTNNAC	1 cut(s)	372
Hpy188I	TCNGA	1 cut(s)	325
Hpy188III	TCNNGA	3 cut(s)	22, 164, 344
Hpy8I	GTNNAC	1 cut(s)	372
HpyCH4III	ACNGT	1 cut(s)	332
HpyCH4V	TGCA	1 cut(s)	149
HpyF10VI	GCNNNNNNNGC	1 cut(s)	116
HpyF3I	CTNAG	2 cut(s)	158, 324
Ksp22I	TGATCA	1 cut(s)	316
Kzo9I	GATC	4 cut(s)	90, 259, 316, 407
LmnI	GCTCC	2 cut(s)	116, 346
LpnPI	CCDG	9 cut(s)	7, 26, 92, 198, 215, 242, 250, 357, 390
MaeI	CTAG	2 cut(s)	245, 418
MalI	GATC	4 cut(s)	92, 261, 318, 409
MboI	GATC	4 cut(s)	90, 259, 316, 407
MboII	GAAGA	3 cut(s)	37, 80, 256
MflI	RGATCY	1 cut(s)	259
MluCI	AATT	1 cut(s)	394
MmeI	TCCRAC	1 cut(s)	259
MnlI	CCTC	7 cut(s)	38, 64, 118, 226, 243, 247, 279
MroXI	GAANNNNTTC	1 cut(s)	357
MseI	TTAA	1 cut(s)	300
MspR9I	CCNGG	1 cut(s)	230
MvaI	CCWGG	1 cut(s)	230
MwoI	GCNNNNNNNGC	1 cut(s)	116
NdeII	GATC	4 cut(s)	90, 259, 316, 407
PceI	AGGCCT	1 cut(s)	236
PdmI	GAANNNNTTC	1 cut(s)	357
PfeI	GAWTC	1 cut(s)	172
PfoI	TCCNGGA	1 cut(s)	228
PkrI	GCNGC	1 cut(s)	242
Psp6I	CCWGG	1 cut(s)	228
PspGI	CCWGG	1 cut(s)	228
PsuI	RGATCY	1 cut(s)	259
RsaI	GTAC	1 cut(s)	329
RsaNI	GTAC	1 cut(s)	328
SaqAI	TTAA	1 cut(s)	300
SatI	GCNGC	1 cut(s)	241
Sau3AI	GATC	4 cut(s)	90, 259, 316, 407
ScaI	AGTACT	1 cut(s)	329
ScrFI	CCNGG	1 cut(s)	230
SetI	ASST	6 cut(s)	49, 75, 129, 306, 343, 406
SfcI	CTRYAG	2 cut(s)	336, 384
Sse9I	AATT	1 cut(s)	394
SseBI	AGGCCT	1 cut(s)	236
SsiI	CCGC	2 cut(s)	11, 240
SspI	AATATT	1 cut(s)	357
SspMI	CTAG	2 cut(s)	245, 418
StuI	AGGCCT	1 cut(s)	236
StyD4I	CCNGG	1 cut(s)	228
TaaI	ACNGT	1 cut(s)	332
TaqI	TCGA	2 cut(s)	93, 294
TasI	AATT	1 cut(s)	394
TatI	WGTACW	1 cut(s)	327
TauI	GCSGC	1 cut(s)	243
TfiI	GAWTC	1 cut(s)	172
Tru1I	TTAA	1 cut(s)	300
Tru9I	TTAA	1 cut(s)	300
TspDTI	ATGAA	1 cut(s)	256
XapI	RAATTY	1 cut(s)	394
XmnI	GAANNNNTTC	1 cut(s)	357
XspI	CTAG	2 cut(s)	245, 418
ZrmI	AGTACT	1 cut(s)	329

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.