Rroxscaffold_1G00073970
NAC Family

Nascent polypeptide-associated complex subunit alpha-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0007551
Physical Location & Seq
Reverse (-)
94905705 .. 94907526
1822 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00073970.1

Sequence Viewer

Length: 180 bp
ATGCTGAAGCTGGGTATGAAGAAAGTCACTGGTGTTAGCAGGGTCACCATCAAGAGAACCAAAAACATTCTGTTTTTCATCTCAAAACCTGATGTGTTCAAAAAGGAAATGCATATGTTTTGTGAAGGAATTGTGATCAAGTTCATGTTGTTGACTTGTTTCTACTTGCAATCAACATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NAC

Protein Analysis

59

Amino Acids

6.92

Weight (kDa)

10.03

Isoelectric Point (pI)

38.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAC PF01849 1 - 34 9e-10 NAC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
AsuHPI GGTGA 1 cut(s) 37
BccI CCATC 1 cut(s) 56
BclI TGATCA 1 cut(s) 135
Bse1I ACTGG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 34
BseYI CCCAGC 1 cut(s) 10
Bsp143I GATC 1 cut(s) 135
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 135
BstEII GGTNACC 1 cut(s) 43
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstPI GGTNACC 1 cut(s) 43
BtsIMutI CAGTG 1 cut(s) 27
CviAII CATG 1 cut(s) 145
CviJI RGCY 1 cut(s) 10
CviKI_1 RGCY 1 cut(s) 10
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 26
Eco91I GGTNACC 1 cut(s) 43
EcoO65I GGTNACC 1 cut(s) 43
EcoT22I ATGCAT 1 cut(s) 114
FaeI CATG 1 cut(s) 148
FaiI YATR 5 cut(s) 17, 114, 116, 146, 178
FatI CATG 1 cut(s) 144
FauNDI CATATG 1 cut(s) 114
FbaI TGATCA 1 cut(s) 135
FspEI CC 8 cut(s) 15, 25, 26, 61, 73, 89, 102, 111
GsaI CCCAGC 1 cut(s) 14
Hin1II CATG 1 cut(s) 148
HincII GTYRAC 1 cut(s) 153
HindII GTYRAC 1 cut(s) 153
HphI GGTGA 1 cut(s) 37
Hpy166II GTNNAC 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 1 cut(s) 153
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 2 cut(s) 112, 169
Hsp92II CATG 1 cut(s) 148
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 3 cut(s) 15, 25, 102
MaeIII GTNAC 2 cut(s) 25, 43
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MboII GAAGA 1 cut(s) 31
MluCI AATT 1 cut(s) 129
Mph1103I ATGCAT 1 cut(s) 114
NdeI CATATG 1 cut(s) 114
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 148
NmuCI GTSAC 2 cut(s) 25, 43
NsiI ATGCAT 1 cut(s) 114
PspEI GGTNACC 1 cut(s) 43
PspFI CCCAGC 1 cut(s) 10
Sau3AI GATC 1 cut(s) 135
SetI ASST 2 cut(s) 12, 91
SgeI CNNG 8 cut(s) 23, 42, 52, 64, 101, 151, 157, 168
Sse9I AATT 1 cut(s) 129
TasI AATT 1 cut(s) 129
TscAI CASTG 1 cut(s) 34
TseFI GTSAC 2 cut(s) 25, 43
Tsp45I GTSAC 2 cut(s) 25, 43
TspDTI ATGAA 3 cut(s) 32, 67, 133
TspRI CASTG 1 cut(s) 34
Zsp2I ATGCAT 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.