Rw4G030500

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Reverse (-)
57235508 .. 57236170
663 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G030500.1

Sequence Viewer

Length: 300 bp
ATGAGCTATATGATACTTGCTTTAATAGTGAGTACCAGGCCAAAACTCGAAGGAACTATTGCAGATGGAGAAGCCTCAAATTCAGAGAGTAGACTGATTTGGTGGTTTCGTGATAGATTGAAGAAGGCCTCGGGAGTTTTCTGGGAAAGAAAAAGGGATTGGGCGGGAGTTTTTAGGAAGATTTTGGATATCTCTGGGAGGTGGGCTTGGGTTTGTTTTGGAAGAGGTGTGTGCCGAGATTGTGATCGAAGACAGGCTTTGGGAGCAAAAGAGGTTATTTCCTGGAGGCCTACCTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

99

Amino Acids

11.51

Weight (kDa)

10.13

Isoelectric Point (pI)

38.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 91
AciI CCGC 1 cut(s) 164
AcsI RAATTY 1 cut(s) 79
AfaI GTAC 1 cut(s) 34
AgsI TTSAA 1 cut(s) 121
AjnI CCWGG 2 cut(s) 35, 281
AjuI GAANNNNNNNTTGG 2 cut(s) 142, 174
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Ama87I CYCGRG 1 cut(s) 130
AoxI GGCC 3 cut(s) 38, 126, 287
ApoI RAATTY 1 cut(s) 79
AvaI CYCGRG 1 cut(s) 130
BbsI GAAGAC 1 cut(s) 256
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 2 cut(s) 37, 283
BfaI CTAG 1 cut(s) 298
Bme1390I CCNGG 2 cut(s) 37, 283
BmeT110I CYCGRG 1 cut(s) 130
BmrFI CCNGG 2 cut(s) 37, 283
BpiI GAAGAC 1 cut(s) 256
BsaBI GATNNNNATC 1 cut(s) 243
BsaJI CCNNGG 1 cut(s) 129
Bse8I GATNNNNATC 1 cut(s) 243
BseBI CCWGG 2 cut(s) 37, 283
BseDI CCNNGG 1 cut(s) 129
BseJI GATNNNNATC 1 cut(s) 243
BshFI GGCC 3 cut(s) 40, 128, 289
BsiHKCI CYCGRG 1 cut(s) 130
BsnI GGCC 3 cut(s) 40, 128, 289
BsoBI CYCGRG 1 cut(s) 130
Bsp143I GATC 1 cut(s) 244
BspACI CCGC 1 cut(s) 164
BspANI GGCC 3 cut(s) 40, 128, 289
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 1 cut(s) 244
Bst2UI CCWGG 2 cut(s) 37, 283
Bst6I CTCTTC 1 cut(s) 217
BstKTI GATC 1 cut(s) 247
BstMBI GATC 1 cut(s) 244
BstMWI GCNNNNNNNGC 1 cut(s) 263
BstNI CCWGG 2 cut(s) 37, 283
BstSCI CCNGG 2 cut(s) 35, 281
BstV2I GAAGAC 1 cut(s) 256
BsuRI GGCC 3 cut(s) 40, 128, 289
Csp6I GTAC 1 cut(s) 33
CviJI RGCY 7 cut(s) 6, 40, 74, 128, 206, 257, 289
CviKI_1 RGCY 7 cut(s) 6, 40, 74, 128, 206, 257, 289
CviQI GTAC 1 cut(s) 33
DpnI GATC 1 cut(s) 246
DpnII GATC 1 cut(s) 244
Eam1104I CTCTTC 1 cut(s) 217
EarI CTCTTC 1 cut(s) 217
Eco147I AGGCCT 2 cut(s) 128, 289
Eco32I GATATC 1 cut(s) 190
Eco88I CYCGRG 1 cut(s) 130
EcoRII CCWGG 2 cut(s) 35, 281
EcoRV GATATC 1 cut(s) 190
FaiI YATR 2 cut(s) 9, 11
FalI AAGNNNNNCTT 2 cut(s) 241, 273
FauI CCCGC 1 cut(s) 157
FblI GTMKAC 1 cut(s) 91
FspBI CTAG 1 cut(s) 298
HaeIII GGCC 3 cut(s) 40, 128, 289
Hpy166II GTNNAC 1 cut(s) 92
Hpy188I TCNGA 1 cut(s) 85
Hpy188III TCNNGA 2 cut(s) 110, 132
Hpy8I GTNNAC 1 cut(s) 92
HpyAV CCTTC 2 cut(s) 44, 118
HpyCH4V TGCA 1 cut(s) 62
HpyF10VI GCNNNNNNNGC 1 cut(s) 263
Kzo9I GATC 1 cut(s) 244
LmnI GCTCC 1 cut(s) 263
LpnPI CCDG 7 cut(s) 22, 49, 127, 180, 239, 268, 295
MaeI CTAG 1 cut(s) 298
MalI GATC 1 cut(s) 246
MboI GATC 1 cut(s) 244
MboII GAAGA 4 cut(s) 133, 190, 234, 261
MluCI AATT 1 cut(s) 79
MnlI CCTC 6 cut(s) 85, 139, 192, 218, 265, 279
MseI TTAA 1 cut(s) 23
MspR9I CCNGG 2 cut(s) 37, 283
MvaI CCWGG 2 cut(s) 37, 283
MwoI GCNNNNNNNGC 1 cut(s) 263
NdeII GATC 1 cut(s) 244
NmeAIII GCCGAG 1 cut(s) 260
PceI AGGCCT 2 cut(s) 128, 289
PfoI TCCNGGA 1 cut(s) 281
Psp6I CCWGG 2 cut(s) 35, 281
PspGI CCWGG 2 cut(s) 35, 281
RsaI GTAC 1 cut(s) 34
RsaNI GTAC 1 cut(s) 33
SaqAI TTAA 1 cut(s) 23
Sau3AI GATC 1 cut(s) 244
ScrFI CCNGG 2 cut(s) 37, 283
SetI ASST 5 cut(s) 8, 203, 229, 276, 296
Sse9I AATT 1 cut(s) 79
SseBI AGGCCT 2 cut(s) 128, 289
SsiI CCGC 1 cut(s) 164
SspMI CTAG 1 cut(s) 298
StuI AGGCCT 2 cut(s) 128, 289
StyD4I CCNGG 2 cut(s) 35, 281
TaqI TCGA 2 cut(s) 48, 247
TasI AATT 1 cut(s) 79
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
XapI RAATTY 1 cut(s) 79
XmiI GTMKAC 1 cut(s) 91
XspI CTAG 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.