RLG00000026511

Cell division cycle protein 48 homolog

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
Physical Location & Seq
Forward (+)
3486280 .. 3486700
421 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000026511

Sequence Viewer

Length: 315 bp
ATGATACTTGCTTTAATAGTGAGTACCAGGCCAAAACTCGAAGGAACTGTTGCAAATGGAGAAGCCTCAAATTCAGAGAGTAGACTGATTTGGTGGTTTCGTGATAGATTGAAGAAGGCCTCGGGAGTTTTCTGGGAAAGAAAGAGGAAGGGTGATCTCTTCATTATGAGAGTTGGAATGAGGAGTGTCGAGTTCAAGGTTATTAAGACTGATCATTCTGAGTACTGTGTTGTAGCTCTAAACATTGAAATATTTCCAATAGGGTTTACTAAAGTGGCTATAGATAAGAATTCTAAAGCTGGATCAAATGTCTAG

Protein Analysis

105

Amino Acids

11.8

Weight (kDa)

9.93

Isoelectric Point (pI)

25.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 82
AclWI GGATC 1 cut(s) 310
AcsI RAATTY 2 cut(s) 70, 289
AfaI GTAC 2 cut(s) 25, 224
AgsI TTSAA 3 cut(s) 112, 196, 248
AjnI CCWGG 1 cut(s) 26
AluBI AGCT 2 cut(s) 236, 299
AluI AGCT 2 cut(s) 236, 299
AlwI GGATC 1 cut(s) 310
Ama87I CYCGRG 1 cut(s) 121
AoxI GGCC 2 cut(s) 29, 117
ApoI RAATTY 2 cut(s) 70, 289
Asp700I GAANNNNTTC 1 cut(s) 252
AsuHPI GGTGA 1 cut(s) 164
AvaI CYCGRG 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 28
BclI TGATCA 1 cut(s) 211
BfaI CTAG 1 cut(s) 313
BfmI CTRYAG 1 cut(s) 279
BmcAI AGTACT 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 28
BmeT110I CYCGRG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 28
BseDI CCNNGG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 210
BseRI GAGGAG 1 cut(s) 196
BshFI GGCC 2 cut(s) 31, 119
BsiHKCI CYCGRG 1 cut(s) 121
BsnI GGCC 2 cut(s) 31, 119
BsoBI CYCGRG 1 cut(s) 121
Bsp143I GATC 3 cut(s) 154, 211, 302
BspANI GGCC 2 cut(s) 31, 119
BspCNI CTCAG 1 cut(s) 211
BspPI GGATC 1 cut(s) 310
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 3 cut(s) 154, 211, 302
Bst2UI CCWGG 1 cut(s) 28
Bst4CI ACNGT 2 cut(s) 49, 227
Bst6I CTCTTC 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 219
BstKTI GATC 3 cut(s) 157, 214, 305
BstMBI GATC 3 cut(s) 154, 211, 302
BstNI CCWGG 1 cut(s) 28
BstSCI CCNGG 1 cut(s) 26
BstSFI CTRYAG 1 cut(s) 279
BsuRI GGCC 2 cut(s) 31, 119
Csp6I GTAC 2 cut(s) 24, 223
CviJI RGCY 6 cut(s) 31, 65, 119, 236, 278, 299
CviKI_1 RGCY 6 cut(s) 31, 65, 119, 236, 278, 299
CviQI GTAC 2 cut(s) 24, 223
DdeI CTNAG 1 cut(s) 219
DpnI GATC 3 cut(s) 156, 213, 304
DpnII GATC 3 cut(s) 154, 211, 302
Eam1104I CTCTTC 1 cut(s) 164
EarI CTCTTC 1 cut(s) 164
Eco147I AGGCCT 1 cut(s) 119
Eco88I CYCGRG 1 cut(s) 121
EcoRI GAATTC 1 cut(s) 289
EcoRII CCWGG 1 cut(s) 26
FaiI YATR 2 cut(s) 167, 281
FbaI TGATCA 1 cut(s) 211
FblI GTMKAC 1 cut(s) 82
FspBI CTAG 1 cut(s) 313
HaeIII GGCC 2 cut(s) 31, 119
HphI GGTGA 1 cut(s) 164
Hpy166II GTNNAC 2 cut(s) 83, 267
Hpy188I TCNGA 2 cut(s) 76, 220
Hpy188III TCNNGA 2 cut(s) 101, 123
Hpy8I GTNNAC 2 cut(s) 83, 267
HpyAV CCTTC 3 cut(s) 35, 109, 142
HpyCH4III ACNGT 2 cut(s) 49, 227
HpyCH4V TGCA 1 cut(s) 53
HpyF3I CTNAG 1 cut(s) 219
Ksp22I TGATCA 1 cut(s) 211
Kzo9I GATC 3 cut(s) 154, 211, 302
LpnPI CCDG 4 cut(s) 13, 40, 118, 285
MaeI CTAG 1 cut(s) 313
MalI GATC 3 cut(s) 156, 213, 304
MboI GATC 3 cut(s) 154, 211, 302
MboII GAAGA 2 cut(s) 124, 151
MluCI AATT 2 cut(s) 70, 289
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 4 cut(s) 76, 130, 138, 174
MroXI GAANNNNTTC 1 cut(s) 252
MseI TTAA 2 cut(s) 14, 204
MspR9I CCNGG 1 cut(s) 28
MvaI CCWGG 1 cut(s) 28
NdeII GATC 3 cut(s) 154, 211, 302
PceI AGGCCT 1 cut(s) 119
PdmI GAANNNNTTC 1 cut(s) 252
Psp6I CCWGG 1 cut(s) 26
PspGI CCWGG 1 cut(s) 26
RsaI GTAC 2 cut(s) 25, 224
RsaNI GTAC 2 cut(s) 24, 223
SaqAI TTAA 2 cut(s) 14, 204
Sau3AI GATC 3 cut(s) 154, 211, 302
ScaI AGTACT 1 cut(s) 224
ScrFI CCNGG 1 cut(s) 28
SetI ASST 3 cut(s) 201, 238, 301
SfcI CTRYAG 1 cut(s) 279
Sse9I AATT 2 cut(s) 70, 289
SseBI AGGCCT 1 cut(s) 119
SspI AATATT 1 cut(s) 252
SspMI CTAG 1 cut(s) 313
StuI AGGCCT 1 cut(s) 119
StyD4I CCNGG 1 cut(s) 26
TaaI ACNGT 2 cut(s) 49, 227
TaqI TCGA 2 cut(s) 39, 189
TasI AATT 2 cut(s) 70, 289
TatI WGTACW 1 cut(s) 222
Tru1I TTAA 2 cut(s) 14, 204
Tru9I TTAA 2 cut(s) 14, 204
TspDTI ATGAA 1 cut(s) 151
XapI RAATTY 2 cut(s) 70, 289
XmiI GTMKAC 1 cut(s) 82
XmnI GAANNNNTTC 1 cut(s) 252
XspI CTAG 1 cut(s) 313
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.