RchiOBHm_Chr3g0482031

Protein of unknown function (DUF1138)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
28125350 .. 28125975
626 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 258 bp
ATGGGCCACGCGAAATACATCTTTCCTGCTGTGTTGGGATCATTTGCAGTGGCATGGACATTTGACCATTTTGTTGCTGACAAGAAGATATTTGGAGGCAAGTTAGTTGGAACTACTCCATCAACTGTTGCAAACAAAGAATGGTGGGAAGCAACTGACAAGAAGTTCCAGGTATGGCCTCGCACTGCCGGTCCACCTGTGGTCATGAATCCCATCAGTAGTCAGAATTTCATTGTGAAGTCGGGCACCGATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.39

Weight (kDa)

9.1

Isoelectric Point (pI)

13.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1138 PF06592 4 - 80 1e-37 Protein of unknown function (DUF1138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 245
AccII CGCG 1 cut(s) 11
AclWI GGATC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 226
AjnI CCWGG 1 cut(s) 168
AlwI GGATC 1 cut(s) 46
AoxI GGCC 2 cut(s) 4, 176
ApoI RAATTY 1 cut(s) 226
AspS9I GGNCC 2 cut(s) 4, 191
AvaII GGWCC 1 cut(s) 191
BaeGI GKGCMC 1 cut(s) 248
BanI GGYRCC 1 cut(s) 245
BccI CCATC 2 cut(s) 127, 221
BciT130I CCWGG 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 170
Bme18I GGWCC 1 cut(s) 191
BmgT120I GGNCC 2 cut(s) 4, 191
BmiI GGNNCC 1 cut(s) 247
BmrFI CCNGG 1 cut(s) 170
Bse118I RCCGGY 1 cut(s) 188
BseBI CCWGG 1 cut(s) 170
BseSI GKGCMC 1 cut(s) 248
Bsh1236I CGCG 1 cut(s) 11
BshFI GGCC 2 cut(s) 6, 178
BshNI GGYRCC 1 cut(s) 245
BsiSI CCGG 1 cut(s) 189
BsnI GGCC 2 cut(s) 6, 178
Bsp1286I GDGCHC 1 cut(s) 248
Bsp143I GATC 1 cut(s) 38
BspANI GGCC 2 cut(s) 6, 178
BspFNI CGCG 1 cut(s) 11
BspHI TCATGA 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 247
BspPI GGATC 1 cut(s) 46
BspT107I GGYRCC 1 cut(s) 245
BsrFI RCCGGY 1 cut(s) 188
BssAI RCCGGY 1 cut(s) 188
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 170
Bst4CI ACNGT 1 cut(s) 127
BstFNI CGCG 1 cut(s) 11
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 170
BstSCI CCNGG 1 cut(s) 168
BstSLI GKGCMC 1 cut(s) 248
BstUI CGCG 1 cut(s) 11
BsuRI GGCC 2 cut(s) 6, 178
BtsI GCAGTG 2 cut(s) 54, 183
BtsIMutI CAGTG 2 cut(s) 54, 183
CciI TCATGA 1 cut(s) 204
Cfr10I RCCGGY 1 cut(s) 188
Cfr13I GGNCC 2 cut(s) 4, 191
CviAII CATG 2 cut(s) 54, 205
CviJI RGCY 2 cut(s) 6, 178
CviKI_1 RGCY 2 cut(s) 6, 178
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eco47I GGWCC 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 168
FaeI CATG 2 cut(s) 57, 208
FaiI YATR 3 cut(s) 55, 175, 206
FatI CATG 2 cut(s) 53, 204
HaeIII GGCC 2 cut(s) 6, 178
HapII CCGG 1 cut(s) 189
Hin1II CATG 2 cut(s) 57, 208
HinfI GANTC 1 cut(s) 208
HpaII CCGG 1 cut(s) 189
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 1 cut(s) 225
Hpy188III TCNNGA 1 cut(s) 205
Hpy8I GTNNAC 1 cut(s) 194
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 47, 131
Hsp92II CATG 2 cut(s) 57, 208
Kzo9I GATC 1 cut(s) 38
LpnPI CCDG 5 cut(s) 39, 155, 182, 202, 210
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 97
MhlI GDGCHC 1 cut(s) 248
MluCI AATT 1 cut(s) 226
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 2 cut(s) 89, 189
MspI CCGG 1 cut(s) 189
MspR9I CCNGG 1 cut(s) 170
MvaI CCWGG 1 cut(s) 170
MvnI CGCG 1 cut(s) 11
NdeII GATC 1 cut(s) 38
NlaIII CATG 2 cut(s) 57, 208
NlaIV GGNNCC 1 cut(s) 247
PagI TCATGA 1 cut(s) 204
PfeI GAWTC 1 cut(s) 208
Psp6I CCWGG 1 cut(s) 168
PspGI CCWGG 1 cut(s) 168
PspN4I GGNNCC 1 cut(s) 247
PspPI GGNCC 2 cut(s) 4, 191
Sau3AI GATC 1 cut(s) 38
Sau96I GGNCC 2 cut(s) 4, 191
ScrFI CCNGG 1 cut(s) 170
SduI GDGCHC 1 cut(s) 248
SetI ASST 2 cut(s) 174, 199
SinI GGWCC 1 cut(s) 191
Sse9I AATT 1 cut(s) 226
StyD4I CCNGG 1 cut(s) 168
TaaI ACNGT 1 cut(s) 127
TasI AATT 1 cut(s) 226
TfiI GAWTC 1 cut(s) 208
TscAI CASTG 2 cut(s) 54, 190
TspDTI ATGAA 2 cut(s) 220, 221
TspRI CASTG 2 cut(s) 54, 190
VpaK11BI GGWCC 1 cut(s) 191
XapI RAATTY 1 cut(s) 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.