RchiOBHm_Chr3g0482071

Protein of unknown function (DUF1138)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
28155471 .. 28157024
1554 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGGGCCACGCGAAATACATCTTTCCTGCTGTGTTGGGATCATTTGCAGTGGCATGGGCATTTGACCATTTTGTTGCTGACAAGAAGATATTTGGAGGAACTACTCCATCAACTGTTGCAAACAAAGAATGGTGGGAAGCAACTGACAAGAAGTTCCAGGCATGGCCTCGCACTGCCGGTCCTCCTGTGGTCATGAATCCCATCAGTCGTCAGAATTTCATTGTGAAGTCAGGCACCGATGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.0

Weight (kDa)

9.16

Isoelectric Point (pI)

16.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1138 PF06592 4 - 76 6.3e-43 Protein of unknown function (DUF1138)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 233
AccII CGCG 1 cut(s) 11
AclWI GGATC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 214
AjnI CCWGG 1 cut(s) 156
AlwI GGATC 1 cut(s) 46
AoxI GGCC 2 cut(s) 4, 164
ApoI RAATTY 1 cut(s) 214
AspS9I GGNCC 2 cut(s) 4, 179
AvaII GGWCC 1 cut(s) 179
BanI GGYRCC 1 cut(s) 233
BccI CCATC 2 cut(s) 115, 209
BciT130I CCWGG 1 cut(s) 158
Bme1390I CCNGG 1 cut(s) 158
Bme18I GGWCC 1 cut(s) 179
BmgT120I GGNCC 2 cut(s) 4, 179
BmiI GGNNCC 1 cut(s) 235
BmrFI CCNGG 1 cut(s) 158
Bse118I RCCGGY 1 cut(s) 176
BseBI CCWGG 1 cut(s) 158
Bsh1236I CGCG 1 cut(s) 11
BshFI GGCC 2 cut(s) 6, 166
BshNI GGYRCC 1 cut(s) 233
BsiSI CCGG 1 cut(s) 177
BsnI GGCC 2 cut(s) 6, 166
Bsp143I GATC 1 cut(s) 38
BspANI GGCC 2 cut(s) 6, 166
BspFNI CGCG 1 cut(s) 11
BspHI TCATGA 1 cut(s) 192
BspLI GGNNCC 1 cut(s) 235
BspPI GGATC 1 cut(s) 46
BspT107I GGYRCC 1 cut(s) 233
BsrFI RCCGGY 1 cut(s) 176
BssAI RCCGGY 1 cut(s) 176
BssMI GATC 1 cut(s) 38
Bst2UI CCWGG 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 115
BstFNI CGCG 1 cut(s) 11
BstKTI GATC 1 cut(s) 41
BstMBI GATC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 158
BstSCI CCNGG 1 cut(s) 156
BstUI CGCG 1 cut(s) 11
BsuRI GGCC 2 cut(s) 6, 166
BtsI GCAGTG 2 cut(s) 54, 171
BtsIMutI CAGTG 2 cut(s) 54, 171
CciI TCATGA 1 cut(s) 192
Cfr10I RCCGGY 1 cut(s) 176
Cfr13I GGNCC 2 cut(s) 4, 179
CviAII CATG 3 cut(s) 54, 162, 193
CviJI RGCY 2 cut(s) 6, 166
CviKI_1 RGCY 2 cut(s) 6, 166
DpnI GATC 1 cut(s) 40
DpnII GATC 1 cut(s) 38
Eco47I GGWCC 1 cut(s) 179
EcoRII CCWGG 1 cut(s) 156
FaeI CATG 3 cut(s) 57, 165, 196
FaiI YATR 3 cut(s) 55, 163, 194
FatI CATG 3 cut(s) 53, 161, 192
HaeIII GGCC 2 cut(s) 6, 166
HapII CCGG 1 cut(s) 177
Hin1II CATG 3 cut(s) 57, 165, 196
HinfI GANTC 1 cut(s) 196
HpaII CCGG 1 cut(s) 177
Hpy188I TCNGA 1 cut(s) 213
Hpy188III TCNNGA 1 cut(s) 193
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 2 cut(s) 47, 119
Hsp92II CATG 3 cut(s) 57, 165, 196
Kzo9I GATC 1 cut(s) 38
LpnPI CCDG 6 cut(s) 39, 143, 170, 190, 198, 216
MalI GATC 1 cut(s) 40
MboI GATC 1 cut(s) 38
MboII GAAGA 1 cut(s) 97
MluCI AATT 1 cut(s) 214
MnlI CCTC 3 cut(s) 89, 177, 192
MspI CCGG 1 cut(s) 177
MspR9I CCNGG 1 cut(s) 158
MvaI CCWGG 1 cut(s) 158
MvnI CGCG 1 cut(s) 11
NdeII GATC 1 cut(s) 38
NlaIII CATG 3 cut(s) 57, 165, 196
NlaIV GGNNCC 1 cut(s) 235
PagI TCATGA 1 cut(s) 192
PfeI GAWTC 1 cut(s) 196
Psp6I CCWGG 1 cut(s) 156
PspGI CCWGG 1 cut(s) 156
PspN4I GGNNCC 1 cut(s) 235
PspPI GGNCC 2 cut(s) 4, 179
Sau3AI GATC 1 cut(s) 38
Sau96I GGNCC 2 cut(s) 4, 179
ScrFI CCNGG 1 cut(s) 158
SinI GGWCC 1 cut(s) 179
Sse9I AATT 1 cut(s) 214
StyD4I CCNGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 115
TasI AATT 1 cut(s) 214
TfiI GAWTC 1 cut(s) 196
TscAI CASTG 2 cut(s) 54, 178
TspDTI ATGAA 2 cut(s) 208, 209
TspRI CASTG 2 cut(s) 54, 178
VpaK11BI GGWCC 1 cut(s) 179
XapI RAATTY 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.