RchiOBHm_Chr3g0482501

helicase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
28558745 .. 28562204
3460 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 318 bp
ATGTTGTCATCGATTGGACTTGAAGAAGTGATGGGTTTTCTTGAACAGTCGTTTCCTGATGTTGAAATAGCTATTGAACTTGGGAAGCCTGCAATATTGAAAGAAGCTAGAGGAAACAATGGAGAAATTCTCACAAGGAATAACAATGTTGAGAATTCTATTGATAGCTACCGCAAAGCCTTTGACATTGTTGACCTGATGGTATATAATGGTACATGTTGTTGGCTCTCTTTTCCAATATATCCGGCTAGGAATCGGCCTGTCTACAAGGCAAATGGTGGCAGCATACTTTGTCACATTGACAGATTACTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

11.72

Weight (kDa)

5.04

Isoelectric Point (pI)

47.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 264
AciI CCGC 1 cut(s) 172
AcsI RAATTY 2 cut(s) 126, 154
AfaI GTAC 1 cut(s) 214
AflIII ACRYGT 1 cut(s) 215
AgsI TTSAA 5 cut(s) 23, 44, 65, 77, 100
AluBI AGCT 3 cut(s) 71, 107, 168
AluI AGCT 3 cut(s) 71, 107, 168
AoxI GGCC 1 cut(s) 257
ApeKI GCWGC 1 cut(s) 282
ApoI RAATTY 2 cut(s) 126, 154
BbvI GCAGC 1 cut(s) 294
BccI CCATC 2 cut(s) 25, 193
BfaI CTAG 2 cut(s) 108, 249
BisI GCNGC 1 cut(s) 283
BlsI GCNGC 1 cut(s) 284
BplI GAGNNNNNCTC 2 cut(s) 114, 146
Bsa29I ATCGAT 1 cut(s) 11
BseCI ATCGAT 1 cut(s) 11
BseXI GCAGC 1 cut(s) 294
BshFI GGCC 1 cut(s) 259
BshVI ATCGAT 1 cut(s) 11
BsiSI CCGG 1 cut(s) 245
BsnI GGCC 1 cut(s) 259
BspACI CCGC 1 cut(s) 172
BspANI GGCC 1 cut(s) 259
BspDI ATCGAT 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 48
BstC8I GCNNGC 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 219
BstV1I GCAGC 1 cut(s) 294
Bsu15I ATCGAT 1 cut(s) 11
BsuRI GGCC 1 cut(s) 259
BsuTUI ATCGAT 1 cut(s) 11
Cac8I GCNNGC 1 cut(s) 90
ClaI ATCGAT 1 cut(s) 11
Csp6I GTAC 1 cut(s) 213
CviAII CATG 1 cut(s) 216
CviJI RGCY 8 cut(s) 71, 88, 107, 168, 179, 226, 248, 259
CviKI_1 RGCY 8 cut(s) 71, 88, 107, 168, 179, 226, 248, 259
CviQI GTAC 1 cut(s) 213
EcoRI GAATTC 1 cut(s) 154
FaeI CATG 1 cut(s) 219
FaiI YATR 5 cut(s) 205, 207, 217, 241, 287
FatI CATG 1 cut(s) 215
FblI GTMKAC 1 cut(s) 264
Fnu4HI GCNGC 1 cut(s) 283
Fsp4HI GCNGC 1 cut(s) 283
FspBI CTAG 2 cut(s) 108, 249
GluI GCNGC 1 cut(s) 283
HaeIII GGCC 1 cut(s) 259
HapII CCGG 1 cut(s) 245
Hin1II CATG 1 cut(s) 219
HincII GTYRAC 1 cut(s) 193
HindII GTYRAC 1 cut(s) 193
HinfI GANTC 1 cut(s) 253
HpaII CCGG 1 cut(s) 245
Hpy166II GTNNAC 2 cut(s) 193, 265
Hpy188III TCNNGA 2 cut(s) 41, 56
Hpy8I GTNNAC 2 cut(s) 193, 265
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 92
Hsp92II CATG 1 cut(s) 219
LpnPI CCDG 5 cut(s) 69, 102, 209, 258, 273
Lsp1109I GCAGC 1 cut(s) 294
MaeI CTAG 2 cut(s) 108, 249
MaeIII GTNAC 1 cut(s) 293
MboII GAAGA 1 cut(s) 35
MluCI AATT 2 cut(s) 126, 154
MnlI CCTC 1 cut(s) 104
MspI CCGG 1 cut(s) 245
NlaIII CATG 1 cut(s) 219
NmuCI GTSAC 1 cut(s) 293
NspI RCATGY 1 cut(s) 219
PciI ACATGT 1 cut(s) 215
PfeI GAWTC 1 cut(s) 253
PkrI GCNGC 1 cut(s) 284
PscI ACATGT 1 cut(s) 215
RsaI GTAC 1 cut(s) 214
RsaNI GTAC 1 cut(s) 213
SatI GCNGC 1 cut(s) 283
SetI ASST 4 cut(s) 73, 109, 170, 198
Sse9I AATT 2 cut(s) 126, 154
SsiI CCGC 1 cut(s) 172
SspI AATATT 1 cut(s) 96
SspMI CTAG 2 cut(s) 108, 249
TaaI ACNGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 126, 154
TfiI GAWTC 1 cut(s) 253
TseFI GTSAC 1 cut(s) 293
TseI GCWGC 1 cut(s) 282
Tsp45I GTSAC 1 cut(s) 293
XapI RAATTY 2 cut(s) 126, 154
XceI RCATGY 1 cut(s) 219
XmiI GTMKAC 1 cut(s) 264
XspI CTAG 2 cut(s) 108, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.