Rh6BG341800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
57366065 .. 57371576
5512 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG341800.1

Sequence Viewer

Length: 417 bp
ATGTTGTCGTCGATTGGACTTGAAGAAGTGATGGGTTTTCTTGAACAGTCGTTTCCTGATGTTGAAATAGCTATTGAACTTGGGAAACACAGTTGTATCAGGAATGACAATGTTGAGAATTCTATTGATAGCTACCGCGAAGCCTTTGACGTTGTTGACCTGATGGTATATAATGCAAATGGTATGGCAGCATACTTTGTCACATTGACAGAGTACTTGCTTGACAGTTTCTTCTGGAGATCAGACATATATAAGCTGGTTGAATTAATTTATCACCTTGTTAATGGACAATGTTCTATACAAGAGATTACTCCAGAGAGAAAAGAGTTAAATGGGAATGATCCAACGGAAGAGAGAGAAAGGGAAGAATTCAAGGAAAAGAGAAGTGAAATAAAAAGAGGAATCCCAGACCGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

16.09

Weight (kDa)

4.52

Isoelectric Point (pI)

44.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 138
AciI CCGC 1 cut(s) 136
AclWI GGATC 1 cut(s) 335
AcsI RAATTY 2 cut(s) 118, 368
AfaI GTAC 1 cut(s) 215
AgsI TTSAA 6 cut(s) 23, 44, 65, 77, 263, 373
AluBI AGCT 3 cut(s) 71, 132, 256
AluI AGCT 3 cut(s) 71, 132, 256
AlwI GGATC 1 cut(s) 335
ApeKI GCWGC 1 cut(s) 188
ApoI RAATTY 2 cut(s) 118, 368
AseI ATTAAT 1 cut(s) 266
AsuHPI GGTGA 1 cut(s) 266
BaeI ACNNNNGTAYC 2 cut(s) 79, 112
BbvI GCAGC 1 cut(s) 200
BccI CCATC 2 cut(s) 25, 157
BisI GCNGC 1 cut(s) 189
BlsI GCNGC 1 cut(s) 190
BmcAI AGTACT 1 cut(s) 215
BpmI CTGGAG 2 cut(s) 256, 297
BseXI GCAGC 1 cut(s) 200
Bsh1236I CGCG 1 cut(s) 138
Bsp143I GATC 2 cut(s) 239, 340
BspACI CCGC 1 cut(s) 136
BspFNI CGCG 1 cut(s) 138
BspPI GGATC 1 cut(s) 335
BssMI GATC 2 cut(s) 239, 340
Bst4CI ACNGT 4 cut(s) 48, 92, 227, 413
Bst6I CTCTTC 1 cut(s) 345
BstFNI CGCG 1 cut(s) 138
BstKTI GATC 2 cut(s) 242, 343
BstMBI GATC 2 cut(s) 239, 340
BstUI CGCG 1 cut(s) 138
BstV1I GCAGC 1 cut(s) 200
Csp6I GTAC 1 cut(s) 214
CviJI RGCY 4 cut(s) 71, 132, 143, 256
CviKI_1 RGCY 4 cut(s) 71, 132, 143, 256
CviQI GTAC 1 cut(s) 214
DpnI GATC 2 cut(s) 241, 342
DpnII GATC 2 cut(s) 239, 340
Eam1104I CTCTTC 1 cut(s) 345
EarI CTCTTC 1 cut(s) 345
EcoRI GAATTC 2 cut(s) 118, 368
FaiI YATR 8 cut(s) 169, 171, 185, 193, 248, 250, 252, 299
Fnu4HI GCNGC 1 cut(s) 189
Fsp4HI GCNGC 1 cut(s) 189
GluI GCNGC 1 cut(s) 189
GsuI CTGGAG 2 cut(s) 256, 297
HincII GTYRAC 1 cut(s) 157
HindII GTYRAC 1 cut(s) 157
HinfI GANTC 1 cut(s) 402
HphI GGTGA 1 cut(s) 266
Hpy166II GTNNAC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 5 cut(s) 41, 56, 100, 235, 314
Hpy8I GTNNAC 1 cut(s) 157
Hpy99I CGWCG 1 cut(s) 13
HpyCH4III ACNGT 4 cut(s) 48, 92, 227, 413
HpyCH4IV ACGT 1 cut(s) 150
HpyCH4V TGCA 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 150
Kzo9I GATC 2 cut(s) 239, 340
LpnPI CCDG 6 cut(s) 69, 85, 173, 220, 242, 327
Lsp1109I GCAGC 1 cut(s) 200
MaeII ACGT 1 cut(s) 150
MaeIII GTNAC 1 cut(s) 199
MalI GATC 2 cut(s) 241, 342
MboI GATC 2 cut(s) 239, 340
MboII GAAGA 4 cut(s) 35, 223, 362, 377
MluCI AATT 4 cut(s) 118, 263, 267, 368
MmeI TCCRAC 1 cut(s) 368
MnlI CCTC 1 cut(s) 392
MseI TTAA 3 cut(s) 266, 282, 329
MvnI CGCG 1 cut(s) 138
NdeII GATC 2 cut(s) 239, 340
NmuCI GTSAC 1 cut(s) 199
PfeI GAWTC 1 cut(s) 402
PkrI GCNGC 1 cut(s) 190
PshBI ATTAAT 1 cut(s) 266
RsaI GTAC 1 cut(s) 215
RsaNI GTAC 1 cut(s) 214
SaqAI TTAA 3 cut(s) 266, 282, 329
SatI GCNGC 1 cut(s) 189
Sau3AI GATC 2 cut(s) 239, 340
ScaI AGTACT 1 cut(s) 215
SetI ASST 6 cut(s) 73, 134, 153, 162, 258, 279
Sse9I AATT 4 cut(s) 118, 263, 267, 368
SsiI CCGC 1 cut(s) 136
TaaI ACNGT 4 cut(s) 48, 92, 227, 413
TaiI ACGT 1 cut(s) 153
TaqI TCGA 1 cut(s) 11
TasI AATT 4 cut(s) 118, 263, 267, 368
TatI WGTACW 1 cut(s) 213
TfiI GAWTC 1 cut(s) 402
Tru1I TTAA 3 cut(s) 266, 282, 329
Tru9I TTAA 3 cut(s) 266, 282, 329
TseFI GTSAC 1 cut(s) 199
TseI GCWGC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 199
TspGWI ACGGA 1 cut(s) 362
VspI ATTAAT 1 cut(s) 266
XapI RAATTY 2 cut(s) 118, 368
ZrmI AGTACT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.