Rh1AG168300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
32071894 .. 32081058
9165 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG168300.1

Sequence Viewer

Length: 222 bp
ATGAACCGATCTGAACAGTGTCTTCAGCCAAGCCGACATGTCGTCGTCAGTCTCCGTCTCATGCATGATTTGATTATCTTACAATGGTTGAATATGCAATATTTGATCATCTTACAACGGTGCAGGCAAATGAATATTGCTTGTGCGACAGTTTCTTCTGGAGATCAGACATATATAAGTCATCCATGGAGGAGAGGAGGAAATTGCACCTACCATGCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.56

Weight (kDa)

9.24

Isoelectric Point (pI)

91.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 8
AflIII ACRYGT 1 cut(s) 37
AgsI TTSAA 1 cut(s) 91
AhdI GACNNNNNGTC 1 cut(s) 41
Alw26I GTCTC 2 cut(s) 56, 62
BbsI GAAGAC 1 cut(s) 14
BclI TGATCA 1 cut(s) 105
BcoDI GTCTC 2 cut(s) 56, 62
BfaI CTAG 1 cut(s) 220
BmeRI GACNNNNNGTC 1 cut(s) 41
BpiI GAAGAC 1 cut(s) 14
BpmI CTGGAG 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 185
BseDI CCNNGG 1 cut(s) 185
BseGI GGATG 1 cut(s) 181
BseRI GAGGAG 2 cut(s) 205, 210
BsgI GTGCAG 1 cut(s) 142
BsmAI GTCTC 2 cut(s) 56, 62
BsmBI CGTCTC 1 cut(s) 62
Bsp143I GATC 3 cut(s) 8, 105, 163
Bsp19I CCATGG 1 cut(s) 185
BssECI CCNNGG 1 cut(s) 185
BssMI GATC 3 cut(s) 8, 105, 163
BssT1I CCWWGG 1 cut(s) 185
Bst4CI ACNGT 3 cut(s) 18, 120, 151
BstC8I GCNNGC 1 cut(s) 125
BstDSI CCRYGG 1 cut(s) 185
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 3 cut(s) 11, 108, 166
BstMAI GTCTC 2 cut(s) 56, 62
BstMBI GATC 3 cut(s) 8, 105, 163
BstNSI RCATGY 1 cut(s) 41
BstV2I GAAGAC 1 cut(s) 14
BtgI CCRYGG 1 cut(s) 185
BtsCI GGATG 1 cut(s) 181
BtsIMutI CAGTG 1 cut(s) 23
Cac8I GCNNGC 1 cut(s) 125
CviAII CATG 5 cut(s) 38, 61, 65, 186, 215
CviJI RGCY 2 cut(s) 28, 33
CviKI_1 RGCY 2 cut(s) 28, 33
DpnI GATC 3 cut(s) 10, 107, 165
DpnII GATC 3 cut(s) 8, 105, 163
DriI GACNNNNNGTC 1 cut(s) 41
Eam1105I GACNNNNNGTC 1 cut(s) 41
Eco130I CCWWGG 1 cut(s) 185
Eco57I CTGAAG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 185
EcoT22I ATGCAT 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 185
Esp3I CGTCTC 1 cut(s) 62
FaeI CATG 5 cut(s) 41, 64, 68, 189, 218
FaiI YATR 9 cut(s) 39, 62, 66, 95, 172, 174, 176, 187, 216
FatI CATG 5 cut(s) 37, 60, 64, 185, 214
FbaI TGATCA 1 cut(s) 105
FokI GGATG 1 cut(s) 168
FspBI CTAG 1 cut(s) 220
GsuI CTGGAG 1 cut(s) 180
Hin1II CATG 5 cut(s) 41, 64, 68, 189, 218
Hpy188I TCNGA 2 cut(s) 13, 168
Hpy188III TCNNGA 1 cut(s) 159
Hpy99I CGWCG 1 cut(s) 47
HpyCH4III ACNGT 3 cut(s) 18, 120, 151
HpyCH4V TGCA 4 cut(s) 64, 97, 123, 207
Hsp92II CATG 5 cut(s) 41, 64, 68, 189, 218
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 3 cut(s) 8, 105, 163
LpnPI CCDG 2 cut(s) 109, 144
MaeI CTAG 1 cut(s) 220
MalI GATC 3 cut(s) 10, 107, 165
MboI GATC 3 cut(s) 8, 105, 163
MboII GAAGA 2 cut(s) 14, 147
MluCI AATT 1 cut(s) 202
MnlI CCTC 3 cut(s) 183, 188, 191
Mph1103I ATGCAT 1 cut(s) 66
NcoI CCATGG 1 cut(s) 185
NdeII GATC 3 cut(s) 8, 105, 163
NlaIII CATG 5 cut(s) 41, 64, 68, 189, 218
NsiI ATGCAT 1 cut(s) 66
NspI RCATGY 1 cut(s) 41
PciI ACATGT 1 cut(s) 37
PscI ACATGT 1 cut(s) 37
Sau3AI GATC 3 cut(s) 8, 105, 163
SetI ASST 1 cut(s) 212
SgeI CNNG 8 cut(s) 42, 50, 73, 77, 136, 153, 171, 198
Sse9I AATT 1 cut(s) 202
SspI AATATT 2 cut(s) 101, 136
SspMI CTAG 1 cut(s) 220
StyI CCWWGG 1 cut(s) 185
TaaI ACNGT 3 cut(s) 18, 120, 151
TasI AATT 1 cut(s) 202
TscAI CASTG 1 cut(s) 23
TspDTI ATGAA 2 cut(s) 17, 146
TspGWI ACGGA 1 cut(s) 44
TspRI CASTG 1 cut(s) 23
XceI RCATGY 1 cut(s) 41
XspI CTAG 1 cut(s) 220
Zsp2I ATGCAT 1 cut(s) 66
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.