Rh3AG248100

helicase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
26606850 .. 26609819
2970 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG248100.1

Sequence Viewer

Length: 330 bp
ATGTTGTCATCGATTGGACTTGAAGAAGTGATGGGTTTTCTTGAACAGTCGTTTCCTGATGTTGAAATAGCTATTGAACTTGGGAAGATGTGTCTTTTTGCAGCAATATTGAAAGAAGCTAGAGGAAACAATGGAGAAATTCTCACAAGGAATAACAATGTTGAGAATTCTATTGATAGCTACCGCAAAGCCTTTGACATTGTTGACCTGATGGTATATAATGGTACATGTTGTTGGCTCTCTTTTCCAATATATCCGGCTAGGAATCGGCCTGTCTACAAGGCAAATGGTGGCAGCATACTTTGTCACATTGACAGATTACTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.19

Weight (kDa)

5.04

Isoelectric Point (pI)

49.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 276
AciI CCGC 1 cut(s) 184
AcsI RAATTY 2 cut(s) 138, 166
AfaI GTAC 1 cut(s) 226
AflIII ACRYGT 1 cut(s) 227
AgsI TTSAA 5 cut(s) 23, 44, 65, 77, 112
AluBI AGCT 3 cut(s) 71, 119, 180
AluI AGCT 3 cut(s) 71, 119, 180
AoxI GGCC 1 cut(s) 269
ApeKI GCWGC 2 cut(s) 101, 294
ApoI RAATTY 2 cut(s) 138, 166
BbvI GCAGC 2 cut(s) 113, 306
BccI CCATC 2 cut(s) 25, 205
BfaI CTAG 2 cut(s) 120, 261
BisI GCNGC 2 cut(s) 102, 295
BlsI GCNGC 2 cut(s) 103, 296
BplI GAGNNNNNCTC 2 cut(s) 126, 158
Bsa29I ATCGAT 1 cut(s) 11
BseCI ATCGAT 1 cut(s) 11
BseXI GCAGC 2 cut(s) 113, 306
BshFI GGCC 1 cut(s) 271
BshVI ATCGAT 1 cut(s) 11
BsiSI CCGG 1 cut(s) 257
BsnI GGCC 1 cut(s) 271
BspACI CCGC 1 cut(s) 184
BspANI GGCC 1 cut(s) 271
BspDI ATCGAT 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 231
BstV1I GCAGC 2 cut(s) 113, 306
Bsu15I ATCGAT 1 cut(s) 11
BsuRI GGCC 1 cut(s) 271
BsuTUI ATCGAT 1 cut(s) 11
ClaI ATCGAT 1 cut(s) 11
Csp6I GTAC 1 cut(s) 225
CviAII CATG 1 cut(s) 228
CviJI RGCY 7 cut(s) 71, 119, 180, 191, 238, 260, 271
CviKI_1 RGCY 7 cut(s) 71, 119, 180, 191, 238, 260, 271
CviQI GTAC 1 cut(s) 225
EcoRI GAATTC 1 cut(s) 166
FaeI CATG 1 cut(s) 231
FaiI YATR 5 cut(s) 217, 219, 229, 253, 299
FatI CATG 1 cut(s) 227
FblI GTMKAC 1 cut(s) 276
Fnu4HI GCNGC 2 cut(s) 102, 295
Fsp4HI GCNGC 2 cut(s) 102, 295
FspBI CTAG 2 cut(s) 120, 261
GluI GCNGC 2 cut(s) 102, 295
HaeIII GGCC 1 cut(s) 271
HapII CCGG 1 cut(s) 257
Hin1II CATG 1 cut(s) 231
HincII GTYRAC 1 cut(s) 205
HindII GTYRAC 1 cut(s) 205
HinfI GANTC 1 cut(s) 265
HpaII CCGG 1 cut(s) 257
Hpy166II GTNNAC 2 cut(s) 205, 277
Hpy188III TCNNGA 2 cut(s) 41, 56
Hpy8I GTNNAC 2 cut(s) 205, 277
HpyCH4III ACNGT 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 101
Hsp92II CATG 1 cut(s) 231
LpnPI CCDG 4 cut(s) 69, 221, 270, 285
Lsp1109I GCAGC 2 cut(s) 113, 306
MaeI CTAG 2 cut(s) 120, 261
MaeIII GTNAC 1 cut(s) 305
MboII GAAGA 2 cut(s) 35, 97
MluCI AATT 2 cut(s) 138, 166
MnlI CCTC 1 cut(s) 116
MspI CCGG 1 cut(s) 257
NlaIII CATG 1 cut(s) 231
NmuCI GTSAC 1 cut(s) 305
NspI RCATGY 1 cut(s) 231
PciI ACATGT 1 cut(s) 227
PfeI GAWTC 1 cut(s) 265
PkrI GCNGC 2 cut(s) 103, 296
PscI ACATGT 1 cut(s) 227
RsaI GTAC 1 cut(s) 226
RsaNI GTAC 1 cut(s) 225
SatI GCNGC 2 cut(s) 102, 295
SetI ASST 4 cut(s) 73, 121, 182, 210
Sse9I AATT 2 cut(s) 138, 166
SsiI CCGC 1 cut(s) 184
SspI AATATT 1 cut(s) 108
SspMI CTAG 2 cut(s) 120, 261
TaaI ACNGT 1 cut(s) 48
TaqI TCGA 1 cut(s) 11
TasI AATT 2 cut(s) 138, 166
TfiI GAWTC 1 cut(s) 265
TseFI GTSAC 1 cut(s) 305
TseI GCWGC 2 cut(s) 101, 294
Tsp45I GTSAC 1 cut(s) 305
XapI RAATTY 2 cut(s) 138, 166
XceI RCATGY 1 cut(s) 231
XmiI GTMKAC 1 cut(s) 276
XspI CTAG 2 cut(s) 120, 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.