Rh4AG347000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
65556874 .. 65559823
2950 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG347000.1

Sequence Viewer

Length: 243 bp
ATGTGTCTTTTTGCAGCAATATTGAAAGAAGCTAGAGGAAACAATGGAGAAATTCTCACAAGGAATAACAATGTTGAGAATTCTATTGATAGCTACCGCAAAGCCTTTGACATTGTTGACCTGATGGTATATAATGGTACATGTTGTTGGCTCTCTTTTCCAATATATCCGGCTAGGAATCGGCCTGTCTACAAGGCAAATGGTGGCAGCATACTTTGTCACATTGACAGATTACTTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.03

Weight (kDa)

8.43

Isoelectric Point (pI)

37.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 189
AciI CCGC 1 cut(s) 97
AcsI RAATTY 2 cut(s) 51, 79
AfaI GTAC 1 cut(s) 139
AflIII ACRYGT 1 cut(s) 140
AgsI TTSAA 1 cut(s) 25
AluBI AGCT 2 cut(s) 32, 93
AluI AGCT 2 cut(s) 32, 93
AoxI GGCC 1 cut(s) 182
ApeKI GCWGC 2 cut(s) 14, 207
ApoI RAATTY 2 cut(s) 51, 79
BbvI GCAGC 2 cut(s) 26, 219
BccI CCATC 1 cut(s) 118
BfaI CTAG 2 cut(s) 33, 174
BisI GCNGC 2 cut(s) 15, 208
BlsI GCNGC 2 cut(s) 16, 209
BplI GAGNNNNNCTC 2 cut(s) 39, 71
BseXI GCAGC 2 cut(s) 26, 219
BshFI GGCC 1 cut(s) 184
BsiSI CCGG 1 cut(s) 170
BsnI GGCC 1 cut(s) 184
BspACI CCGC 1 cut(s) 97
BspANI GGCC 1 cut(s) 184
BstNSI RCATGY 1 cut(s) 144
BstV1I GCAGC 2 cut(s) 26, 219
BsuRI GGCC 1 cut(s) 184
Csp6I GTAC 1 cut(s) 138
CviAII CATG 1 cut(s) 141
CviJI RGCY 6 cut(s) 32, 93, 104, 151, 173, 184
CviKI_1 RGCY 6 cut(s) 32, 93, 104, 151, 173, 184
CviQI GTAC 1 cut(s) 138
EcoRI GAATTC 1 cut(s) 79
FaeI CATG 1 cut(s) 144
FaiI YATR 5 cut(s) 130, 132, 142, 166, 212
FatI CATG 1 cut(s) 140
FblI GTMKAC 1 cut(s) 189
Fnu4HI GCNGC 2 cut(s) 15, 208
Fsp4HI GCNGC 2 cut(s) 15, 208
FspBI CTAG 2 cut(s) 33, 174
GluI GCNGC 2 cut(s) 15, 208
HaeIII GGCC 1 cut(s) 184
HapII CCGG 1 cut(s) 170
Hin1II CATG 1 cut(s) 144
HincII GTYRAC 1 cut(s) 118
HindII GTYRAC 1 cut(s) 118
HinfI GANTC 1 cut(s) 178
HpaII CCGG 1 cut(s) 170
Hpy166II GTNNAC 2 cut(s) 118, 190
Hpy8I GTNNAC 2 cut(s) 118, 190
HpyCH4V TGCA 1 cut(s) 14
Hsp92II CATG 1 cut(s) 144
LpnPI CCDG 3 cut(s) 134, 183, 198
Lsp1109I GCAGC 2 cut(s) 26, 219
MaeI CTAG 2 cut(s) 33, 174
MaeIII GTNAC 1 cut(s) 218
MluCI AATT 2 cut(s) 51, 79
MnlI CCTC 1 cut(s) 29
MspI CCGG 1 cut(s) 170
NlaIII CATG 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 218
NspI RCATGY 1 cut(s) 144
PciI ACATGT 1 cut(s) 140
PfeI GAWTC 1 cut(s) 178
PkrI GCNGC 2 cut(s) 16, 209
PscI ACATGT 1 cut(s) 140
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SatI GCNGC 2 cut(s) 15, 208
SetI ASST 3 cut(s) 34, 95, 123
SgeI CNNG 8 cut(s) 45, 72, 133, 153, 182, 186, 197, 205
Sse9I AATT 2 cut(s) 51, 79
SsiI CCGC 1 cut(s) 97
SspI AATATT 1 cut(s) 21
SspMI CTAG 2 cut(s) 33, 174
TasI AATT 2 cut(s) 51, 79
TfiI GAWTC 1 cut(s) 178
TseFI GTSAC 1 cut(s) 218
TseI GCWGC 2 cut(s) 14, 207
Tsp45I GTSAC 1 cut(s) 218
XapI RAATTY 2 cut(s) 51, 79
XceI RCATGY 1 cut(s) 144
XmiI GTMKAC 1 cut(s) 189
XspI CTAG 2 cut(s) 33, 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.