Rh2DG226600

CarD-like/TRCF domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0005934
Physical Location & Seq
Reverse (-)
22320567 .. 22324274
3708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG226600.1

Sequence Viewer

Length: 408 bp
ATGATCGACAGTTCTGGATGTCGTTGTCGATTGCAATATTCAAAGCAGCTAGAGGAAACCATGGAGAAATTTTCACAAGGTGAAATCAAGATTCTCACATGCACTAATATAGTAGAAAGTGGGCTTGACATTCAAAATGCAAATACCATTATAATTGAGGATGTTCAACAATTTGGCCTAGCACAGTTGTATCAGATGGTATATAATGGTACATGTTGTTGGCTCTCTTTTCCAATATTTCCGGCTGGGAATCGGCCTGTCTACAAGGTAAATGGTATGGCAGCATACTTTGTCACATGGACAGATTACTTGCTTGACAGTTTCTTCTGGAAATCAGACATTATAAGTCATCCATGGGGGAGAAGAGGAAATTGCAGTATCATGCCTAGAATTAAGGCCTATTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CarD_CdnL_TRCF DEAD Helicase_C TRCF

Protein Analysis

135

Amino Acids

15.53

Weight (kDa)

6.54

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Helicase_C PF00271 15 - 67 1.2e-10 Helicase conserved C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 152, 344
AccI GTMKAC 1 cut(s) 261
AcsI RAATTY 1 cut(s) 68
AdeI CACNNNGTG 1 cut(s) 80
AfaI GTAC 1 cut(s) 211
AflIII ACRYGT 1 cut(s) 212
AgsI TTSAA 3 cut(s) 42, 134, 167
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AoxI GGCC 3 cut(s) 175, 254, 396
ApeKI GCWGC 2 cut(s) 46, 281
ApoI RAATTY 1 cut(s) 68
AsuHPI GGTGA 1 cut(s) 92
BaeI ACNNNNGTAYC 2 cut(s) 173, 206
BbvI GCAGC 2 cut(s) 58, 293
BccI CCATC 1 cut(s) 190
BfaI CTAG 4 cut(s) 50, 179, 387, 406
BisI GCNGC 2 cut(s) 47, 282
BlsI GCNGC 2 cut(s) 48, 283
BsaJI CCNNGG 2 cut(s) 60, 353
BseDI CCNNGG 2 cut(s) 60, 353
BseGI GGATG 3 cut(s) 23, 166, 349
BseXI GCAGC 2 cut(s) 58, 293
BseYI CCCAGC 1 cut(s) 245
BshFI GGCC 3 cut(s) 177, 256, 398
BsiSI CCGG 1 cut(s) 242
BsnI GGCC 3 cut(s) 177, 256, 398
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 2 cut(s) 60, 353
BspANI GGCC 3 cut(s) 177, 256, 398
BssECI CCNNGG 2 cut(s) 60, 353
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 2 cut(s) 60, 353
Bst4CI ACNGT 3 cut(s) 11, 186, 320
Bst6I CTCTTC 1 cut(s) 358
BstDSI CCRYGG 2 cut(s) 60, 353
BstF5I GGATG 3 cut(s) 23, 166, 349
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 2 cut(s) 102, 216
BstV1I GCAGC 2 cut(s) 58, 293
BsuRI GGCC 3 cut(s) 177, 256, 398
BtgI CCRYGG 2 cut(s) 60, 353
BtsCI GGATG 3 cut(s) 23, 166, 349
Csp6I GTAC 1 cut(s) 210
CviAII CATG 6 cut(s) 61, 99, 213, 297, 354, 382
CviJI RGCY 7 cut(s) 49, 124, 177, 223, 245, 256, 398
CviKI_1 RGCY 7 cut(s) 49, 124, 177, 223, 245, 256, 398
CviQI GTAC 1 cut(s) 210
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DraIII CACNNNGTG 1 cut(s) 80
Eam1104I CTCTTC 1 cut(s) 358
EarI CTCTTC 1 cut(s) 358
Eco130I CCWWGG 2 cut(s) 60, 353
Eco147I AGGCCT 1 cut(s) 398
EcoT14I CCWWGG 2 cut(s) 60, 353
ErhI CCWWGG 2 cut(s) 60, 353
FaeI CATG 6 cut(s) 64, 102, 216, 300, 357, 385
FatI CATG 6 cut(s) 60, 98, 212, 296, 353, 381
FblI GTMKAC 1 cut(s) 261
Fnu4HI GCNGC 2 cut(s) 47, 282
FokI GGATG 3 cut(s) 30, 173, 336
Fsp4HI GCNGC 2 cut(s) 47, 282
FspBI CTAG 4 cut(s) 50, 179, 387, 406
GluI GCNGC 2 cut(s) 47, 282
GsaI CCCAGC 1 cut(s) 249
HaeIII GGCC 3 cut(s) 177, 256, 398
HapII CCGG 1 cut(s) 242
Hin1II CATG 6 cut(s) 64, 102, 216, 300, 357, 385
HinfI GANTC 2 cut(s) 91, 250
HpaII CCGG 1 cut(s) 242
HphI GGTGA 1 cut(s) 92
Hpy166II GTNNAC 1 cut(s) 262
Hpy188I TCNGA 2 cut(s) 195, 337
Hpy188III TCNNGA 3 cut(s) 15, 88, 328
Hpy8I GTNNAC 1 cut(s) 262
HpyCH4III ACNGT 3 cut(s) 11, 186, 320
HpyCH4V TGCA 4 cut(s) 34, 102, 140, 375
Hsp92II CATG 6 cut(s) 64, 102, 216, 300, 357, 385
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 4 cut(s) 231, 255, 270, 313
Lsp1109I GCAGC 2 cut(s) 58, 293
MaeI CTAG 4 cut(s) 50, 179, 387, 406
MaeIII GTNAC 1 cut(s) 292
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 316, 375
MluCI AATT 5 cut(s) 68, 153, 170, 370, 390
MnlI CCTC 3 cut(s) 46, 151, 359
MseI TTAA 1 cut(s) 393
MspI CCGG 1 cut(s) 242
NcoI CCATGG 2 cut(s) 60, 353
NdeII GATC 1 cut(s) 3
NlaIII CATG 6 cut(s) 64, 102, 216, 300, 357, 385
NmuCI GTSAC 1 cut(s) 292
NspI RCATGY 2 cut(s) 102, 216
PceI AGGCCT 1 cut(s) 398
PciI ACATGT 1 cut(s) 212
PfeI GAWTC 2 cut(s) 91, 250
PkrI GCNGC 2 cut(s) 48, 283
PscI ACATGT 1 cut(s) 212
PsiI TTATAA 2 cut(s) 152, 344
PspFI CCCAGC 1 cut(s) 245
RsaI GTAC 1 cut(s) 211
RsaNI GTAC 1 cut(s) 210
SaqAI TTAA 1 cut(s) 393
SatI GCNGC 2 cut(s) 47, 282
Sau3AI GATC 1 cut(s) 3
SetI ASST 3 cut(s) 51, 82, 270
Sse9I AATT 5 cut(s) 68, 153, 170, 370, 390
SseBI AGGCCT 1 cut(s) 398
SspI AATATT 2 cut(s) 38, 237
SspMI CTAG 4 cut(s) 50, 179, 387, 406
StuI AGGCCT 1 cut(s) 398
StyI CCWWGG 2 cut(s) 60, 353
TaaI ACNGT 3 cut(s) 11, 186, 320
TaqI TCGA 2 cut(s) 6, 28
TasI AATT 5 cut(s) 68, 153, 170, 370, 390
TfiI GAWTC 2 cut(s) 91, 250
Tru1I TTAA 1 cut(s) 393
Tru9I TTAA 1 cut(s) 393
TseFI GTSAC 1 cut(s) 292
TseI GCWGC 2 cut(s) 46, 281
Tsp45I GTSAC 1 cut(s) 292
XapI RAATTY 1 cut(s) 68
XceI RCATGY 2 cut(s) 102, 216
XmiI GTMKAC 1 cut(s) 261
XspI CTAG 4 cut(s) 50, 179, 387, 406
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.