RchiOBHm_Chr3g0487821

protein DJ-1 homolog D-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
35150265 .. 35150459
195 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 195 bp
ATGCAGGGAAGGAAATGTACTGCACACCCAACGGTCAGGATCAATGTAGTTTTGTCAGAAGCAAAATGGGTGGAACCTGATCCAATAGATAGTTCTATTACAGATGAAAATCTGGTAACTGGAGCTGTTTGGCTGGGCCATCCCGACTTCATTTTTCAGTTGATGGCATTGCTTGCTGTTCGAGTATCATTCTAA

Protein Analysis

64

Amino Acids

7.12

Weight (kDa)

5.43

Isoelectric Point (pI)

18.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DJ-1_PfpI PF01965 2 - 56 2.2e-07 DJ-1/PfpI family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 47, 74
AfaI GTAC 1 cut(s) 19
AjuI GAANNNNNNNTTGG 2 cut(s) 76, 108
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AlwI GGATC 2 cut(s) 47, 74
AoxI GGCC 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 136
BarI GAAGNNNNNNTAC 1 cut(s) 33
BccI CCATC 2 cut(s) 147, 157
BmgT120I GGNCC 1 cut(s) 136
BmiI GGNNCC 1 cut(s) 75
BpmI CTGGAG 1 cut(s) 141
BsaBI GATNNNNATC 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 167
Bse8I GATNNNNATC 1 cut(s) 108
BseGI GGATG 1 cut(s) 139
BseJI GATNNNNATC 1 cut(s) 108
BseMI GCAATG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 124
BseYI CCCAGC 1 cut(s) 133
BsgI GTGCAG 1 cut(s) 6
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 2 cut(s) 39, 79
BspANI GGCC 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 75
BspPI GGATC 2 cut(s) 47, 74
BsrDI GCAATG 1 cut(s) 167
BsrI ACTGG 1 cut(s) 124
BssMI GATC 2 cut(s) 39, 79
Bst4CI ACNGT 1 cut(s) 34
BstAPI GCANNNNNTGC 1 cut(s) 173
BstC8I GCNNGC 1 cut(s) 174
BstF5I GGATG 1 cut(s) 139
BstKTI GATC 2 cut(s) 42, 82
BstMBI GATC 2 cut(s) 39, 79
BstMWI GCNNNNNNNGC 1 cut(s) 173
BsuRI GGCC 1 cut(s) 138
BtsCI GGATG 1 cut(s) 139
Cac8I GCNNGC 1 cut(s) 174
Cfr13I GGNCC 1 cut(s) 136
Csp6I GTAC 1 cut(s) 18
CspCI CAANNNNNGTGG 2 cut(s) 51, 86
CviJI RGCY 3 cut(s) 125, 133, 138
CviKI_1 RGCY 3 cut(s) 125, 133, 138
CviQI GTAC 1 cut(s) 18
DpnI GATC 2 cut(s) 41, 81
DpnII GATC 2 cut(s) 39, 79
FokI GGATG 1 cut(s) 126
GsaI CCCAGC 1 cut(s) 137
GsuI CTGGAG 1 cut(s) 141
HaeIII GGCC 1 cut(s) 138
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 2 cut(s) 37, 143
HpyAV CCTTC 1 cut(s) 3
HpyCH4III ACNGT 1 cut(s) 34
HpyCH4V TGCA 2 cut(s) 4, 23
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
Kzo9I GATC 2 cut(s) 39, 79
LmnI GCTCC 1 cut(s) 122
LpnPI CCDG 5 cut(s) 22, 90, 98, 105, 119
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 41, 81
MboI GATC 2 cut(s) 39, 79
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 2 cut(s) 39, 79
NlaIV GGNNCC 1 cut(s) 75
PspFI CCCAGC 1 cut(s) 133
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 136
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
Sau3AI GATC 2 cut(s) 39, 79
Sau96I GGNCC 1 cut(s) 136
SetI ASST 2 cut(s) 79, 127
SgeI CNNG 8 cut(s) 17, 49, 89, 125, 132, 146, 155, 185
TaaI ACNGT 1 cut(s) 34
TaqI TCGA 1 cut(s) 181
TatI WGTACW 1 cut(s) 17
TspDTI ATGAA 2 cut(s) 120, 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.