RchiOBHm_Chr3g0490961

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
37601046 .. 37602409
1364 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGCAGAAATCAGATTCTCTGGATAGCTTATTTGGCGACAAAGATGCAAGTAGTGCTCTGGAAGTTTCTGGTATGATTCAACCAAAAGAGGAACCTGATTTACCTGATGGACCTGACGATGGAAAAAAGGCGTCCTTACTTATGATGAATTTTTCTAGAGATGAAGTTGAGTTTGCAATGAATATGCTTGGTGATCAAGATGGAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.44

Weight (kDa)

4.05

Isoelectric Point (pI)

29.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 148
AcyI GRCGYC 1 cut(s) 131
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 80
AluBI AGCT 1 cut(s) 27
AluI AGCT 1 cut(s) 27
Alw21I GWGCWC 1 cut(s) 58
ApoI RAATTY 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 110
AsuHPI GGTGA 1 cut(s) 203
AvaII GGWCC 1 cut(s) 110
Bbv12I GWGCWC 1 cut(s) 58
BccI CCATC 3 cut(s) 101, 113, 194
BcgI CGANNNNNNTGC 2 cut(s) 26, 60
BclI TGATCA 1 cut(s) 193
BfaI CTAG 1 cut(s) 156
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 93
BmsI GCATC 1 cut(s) 34
BsaHI GRCGYC 1 cut(s) 131
Bsc4I CCNNNNNNNGG 1 cut(s) 119
Bse3DI GCAATG 1 cut(s) 183
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMI GCAATG 1 cut(s) 183
BsiHKAI GWGCWC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 119
Bsp1286I GDGCHC 1 cut(s) 58
Bsp143I GATC 1 cut(s) 193
BspLI GGNNCC 1 cut(s) 93
BsrDI GCAATG 1 cut(s) 183
BssMI GATC 1 cut(s) 193
BssNI GRCGYC 1 cut(s) 131
BstACI GRCGYC 1 cut(s) 131
BstAPI GCANNNNNTGC 1 cut(s) 53
BstKTI GATC 1 cut(s) 196
BstMBI GATC 1 cut(s) 193
BstMWI GCNNNNNNNGC 2 cut(s) 33, 53
Cfr13I GGNCC 1 cut(s) 110
CseI GACGC 1 cut(s) 120
CviJI RGCY 2 cut(s) 27, 207
CviKI_1 RGCY 2 cut(s) 27, 207
DpnI GATC 1 cut(s) 195
DpnII GATC 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 110
FaiI YATR 3 cut(s) 74, 143, 185
FalI AAGNNNNNCTT 2 cut(s) 119, 151
FbaI TGATCA 1 cut(s) 193
FspBI CTAG 1 cut(s) 156
HgaI GACGC 1 cut(s) 120
Hin1I GRCGYC 1 cut(s) 131
HinfI GANTC 2 cut(s) 14, 76
HphI GGTGA 1 cut(s) 203
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 4 cut(s) 20, 59, 156, 197
HpyCH4V TGCA 3 cut(s) 4, 47, 176
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 53
Hsp92I GRCGYC 1 cut(s) 131
Ksp22I TGATCA 1 cut(s) 193
Kzo9I GATC 1 cut(s) 193
LpnPI CCDG 6 cut(s) 5, 44, 54, 108, 117, 126
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 156
MalI GATC 1 cut(s) 195
MboI GATC 1 cut(s) 193
MhlI GDGCHC 1 cut(s) 58
MluCI AATT 1 cut(s) 148
MnlI CCTC 2 cut(s) 82, 197
MwoI GCNNNNNNNGC 2 cut(s) 33, 53
NdeII GATC 1 cut(s) 193
NlaIV GGNNCC 1 cut(s) 93
PfeI GAWTC 2 cut(s) 14, 76
PspN4I GGNNCC 1 cut(s) 93
PspPI GGNCC 1 cut(s) 110
PsrI GAACNNNNNNTAC 2 cut(s) 84, 116
Sau3AI GATC 1 cut(s) 193
Sau96I GGNCC 1 cut(s) 110
SduI GDGCHC 1 cut(s) 58
SetI ASST 4 cut(s) 29, 97, 106, 115
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 9 cut(s) 32, 60, 71, 81, 107, 116, 125, 168, 200
SinI GGWCC 1 cut(s) 110
Sse9I AATT 1 cut(s) 148
SspMI CTAG 1 cut(s) 156
TasI AATT 1 cut(s) 148
TfiI GAWTC 2 cut(s) 14, 76
TspDTI ATGAA 3 cut(s) 161, 177, 194
VpaK11BI GGWCC 1 cut(s) 110
XapI RAATTY 1 cut(s) 148
XbaI TCTAGA 1 cut(s) 155
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.