Rh5CG578600

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
82121997 .. 82123230
1234 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG578600.1

Sequence Viewer

Length: 243 bp
ATGTTTCATTCACTCTGGAAATCAGATTCTGGGTCATCAGATTCTCTGGATAGCTTATTTGGCGACAAAGATGCAAGCAGTGCTCTGGAAGTTTCTAGTATGATTCAACCAAAAGAGGCTGATTACCCATTTTGTTGCCTATCAGTTGAAGATGCTCCAATCAATGACTTGGTAGATTTTATCATTGCTTCTCAGATATCTGTGAAACTTGAGAATGAGCACAACTGCCATATCTATAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.9

Weight (kDa)

4.33

Isoelectric Point (pI)

46.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 107, 149
AluBI AGCT 1 cut(s) 54
AluI AGCT 1 cut(s) 54
Alw21I GWGCWC 2 cut(s) 85, 222
AlwNI CAGNNNCTG 1 cut(s) 29
Bbv12I GWGCWC 2 cut(s) 85, 222
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 235
BmsI GCATC 2 cut(s) 61, 142
BpuEI CTTGAG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 183
BseMI GCAATG 1 cut(s) 183
BseMII CTCAG 1 cut(s) 206
BsiHKAI GWGCWC 2 cut(s) 85, 222
Bsp1286I GDGCHC 2 cut(s) 85, 222
BspCNI CTCAG 1 cut(s) 205
BsrDI GCAATG 1 cut(s) 183
BstAPI GCANNNNNTGC 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 192
BstMWI GCNNNNNNNGC 2 cut(s) 60, 80
BstSFI CTRYAG 1 cut(s) 235
BtsI GCAGTG 1 cut(s) 85
BtsIMutI CAGTG 1 cut(s) 85
Cac8I GCNNGC 1 cut(s) 76
CaiI CAGNNNCTG 1 cut(s) 29
CviJI RGCY 2 cut(s) 54, 119
CviKI_1 RGCY 2 cut(s) 54, 119
DdeI CTNAG 1 cut(s) 192
Eco32I GATATC 1 cut(s) 198
EcoRV GATATC 1 cut(s) 198
FaiI YATR 3 cut(s) 101, 231, 237
FspBI CTAG 1 cut(s) 96
HinfI GANTC 3 cut(s) 26, 41, 103
Hpy188I TCNGA 3 cut(s) 25, 40, 195
Hpy188III TCNNGA 3 cut(s) 16, 47, 86
HpyCH4V TGCA 1 cut(s) 74
HpyF10VI GCNNNNNNNGC 2 cut(s) 60, 80
HpyF3I CTNAG 1 cut(s) 192
LmnI GCTCC 1 cut(s) 160
LpnPI CCDG 3 cut(s) 15, 32, 71
LweI GCATC 2 cut(s) 61, 142
MaeI CTAG 1 cut(s) 96
MboII GAAGA 1 cut(s) 161
MhlI GDGCHC 2 cut(s) 85, 222
MnlI CCTC 1 cut(s) 109
MwoI GCNNNNNNNGC 2 cut(s) 60, 80
PfeI GAWTC 3 cut(s) 26, 41, 103
PstNI CAGNNNCTG 1 cut(s) 29
SduI GDGCHC 2 cut(s) 85, 222
SetI ASST 2 cut(s) 56, 242
SfaNI GCATC 2 cut(s) 61, 142
SfcI CTRYAG 1 cut(s) 235
SgeI CNNG 8 cut(s) 28, 42, 59, 87, 98, 108, 181, 221
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
SspMI CTAG 1 cut(s) 96
TfiI GAWTC 3 cut(s) 26, 41, 103
TscAI CASTG 1 cut(s) 85
TspRI CASTG 1 cut(s) 85
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.