Rh7BG186400

DNA (cytosine-5)-methyltransferase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
14977526 .. 14978749
1224 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG186400.1

Sequence Viewer

Length: 315 bp
ATGCAGAAATCAGATTCTGGGTCATCAGATTCTCTGGATAGCTTATTTGGCGACAAAGATGCAAGCAGTGCTCTGGAAGTTTCTAGTATGATTCAACCAAAAGAGGCTGATTACCCATTTTGTTGCCTATCAGTTGAAGATGCTCCAATCAATGACTTGGTAGATTTTATCATTGCTTCTCAGATATCTGTGAAACTTGAGAATGAGCACAACTGCCATATGTATAGGTCTTGTGTGAAAATTAAAGTCGGACAATTTCAGAGGGGAATCGTACTTGGTATTAATAAAGGTGGTGTTGATGTCTGCAACTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.29

Weight (kDa)

4.64

Isoelectric Point (pI)

32.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 273
AgsI TTSAA 2 cut(s) 95, 137
AluBI AGCT 1 cut(s) 42
AluI AGCT 1 cut(s) 42
Alw21I GWGCWC 2 cut(s) 73, 210
AlwNI CAGNNNCTG 1 cut(s) 17
AseI ATTAAT 1 cut(s) 282
Bbv12I GWGCWC 2 cut(s) 73, 210
BcgI CGANNNNNNTGC 2 cut(s) 41, 75
BfaI CTAG 1 cut(s) 84
BmsI GCATC 2 cut(s) 49, 130
BpuEI CTTGAG 1 cut(s) 218
Bse3DI GCAATG 1 cut(s) 171
BseMI GCAATG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 194
BsiHKAI GWGCWC 2 cut(s) 73, 210
Bsp1286I GDGCHC 2 cut(s) 73, 210
BspCNI CTCAG 1 cut(s) 193
BsrDI GCAATG 1 cut(s) 171
BstAPI GCANNNNNTGC 1 cut(s) 68
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 180
BstMWI GCNNNNNNNGC 2 cut(s) 48, 68
BtsI GCAGTG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 64
CaiI CAGNNNCTG 1 cut(s) 17
Csp6I GTAC 1 cut(s) 272
CviJI RGCY 2 cut(s) 42, 107
CviKI_1 RGCY 2 cut(s) 42, 107
CviQI GTAC 1 cut(s) 272
DdeI CTNAG 1 cut(s) 180
Eco32I GATATC 1 cut(s) 186
EcoRV GATATC 1 cut(s) 186
FaiI YATR 4 cut(s) 89, 219, 221, 225
FauNDI CATATG 1 cut(s) 219
FspBI CTAG 1 cut(s) 84
HinfI GANTC 4 cut(s) 14, 29, 91, 267
Hpy188I TCNGA 5 cut(s) 13, 28, 183, 251, 261
Hpy188III TCNNGA 2 cut(s) 35, 74
HpyCH4V TGCA 3 cut(s) 4, 62, 306
HpyF10VI GCNNNNNNNGC 2 cut(s) 48, 68
HpyF3I CTNAG 1 cut(s) 180
LmnI GCTCC 1 cut(s) 148
LpnPI CCDG 3 cut(s) 3, 20, 59
LweI GCATC 2 cut(s) 49, 130
MaeI CTAG 1 cut(s) 84
MboII GAAGA 1 cut(s) 149
MhlI GDGCHC 2 cut(s) 73, 210
MluCI AATT 2 cut(s) 240, 254
MmeI TCCRAC 1 cut(s) 229
MnlI CCTC 2 cut(s) 97, 255
MseI TTAA 2 cut(s) 243, 282
MwoI GCNNNNNNNGC 2 cut(s) 48, 68
NdeI CATATG 1 cut(s) 219
PfeI GAWTC 4 cut(s) 14, 29, 91, 267
PshBI ATTAAT 1 cut(s) 282
PstNI CAGNNNCTG 1 cut(s) 17
RsaI GTAC 1 cut(s) 273
RsaNI GTAC 1 cut(s) 272
SaqAI TTAA 2 cut(s) 243, 282
SduI GDGCHC 2 cut(s) 73, 210
SetI ASST 3 cut(s) 44, 230, 292
SfaNI GCATC 2 cut(s) 49, 130
SgeI CNNG 9 cut(s) 30, 47, 75, 86, 96, 169, 209, 243, 287
SmlI CTYRAG 1 cut(s) 197
SmoI CTYRAG 1 cut(s) 197
Sse9I AATT 2 cut(s) 240, 254
SspMI CTAG 1 cut(s) 84
TasI AATT 2 cut(s) 240, 254
TfiI GAWTC 4 cut(s) 14, 29, 91, 267
Tru1I TTAA 2 cut(s) 243, 282
Tru9I TTAA 2 cut(s) 243, 282
TscAI CASTG 1 cut(s) 73
TspRI CASTG 1 cut(s) 73
VspI ATTAAT 1 cut(s) 282
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.