RchiOBHm_Chr2g0146111

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
63826009 .. 63828604
2596 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 204 bp
ATGAAGTTGTCATCGGCAAAAGCAACAACTGGATTTGGGATCATTTATACATCTTCAGAAGAAGAGGAGGATAATATACTCCAGAAAAAAACAATGACAAAATGCTCTCATCGTTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGGTCATGGCATTCGATGAAACGACTTAA

Protein Analysis

67

Amino Acids

7.66

Weight (kDa)

5.58

Isoelectric Point (pI)

70.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 22 - 57 1.7e-10 RING-H2 zinc finger domain
zf-C3HC4 PF00097 26 - 57 2.7e-07 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4_2 PF13923 28 - 57 8e-08 Zinc finger, C3HC4 type (RING finger)
zf-RING_2 PF13639 30 - 57 3.7e-09 Ring finger domain
zf-ANAPC11 PF12861 32 - 64 7.3e-06 Anaphase-promoting complex subunit 11 RING-H2 finger
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 47
AcuI CTGAAG 1 cut(s) 39
AlwI GGATC 1 cut(s) 47
BccI CCATC 1 cut(s) 136
BpmI CTGGAG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 34
BseGI GGATG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 80
BsmI GAATGC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 39
BspPI GGATC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 39
Bst6I CTCTTC 1 cut(s) 57
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BtsCI GGATG 1 cut(s) 147
CviAII CATG 1 cut(s) 181
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
Eam1104I CTCTTC 1 cut(s) 57
EarI CTCTTC 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 39
FaeI CATG 1 cut(s) 184
FaiI YATR 6 cut(s) 48, 77, 131, 133, 135, 182
FatI CATG 1 cut(s) 180
FokI GGATG 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 65
Hin1II CATG 1 cut(s) 184
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 82
Hsp92II CATG 1 cut(s) 184
Kzo9I GATC 1 cut(s) 39
LpnPI CCDG 3 cut(s) 15, 95, 177
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 3 cut(s) 45, 71, 74
MnlI CCTC 2 cut(s) 58, 61
MseI TTAA 1 cut(s) 202
Mva1269I GAATGC 1 cut(s) 185
NdeII GATC 1 cut(s) 39
NlaIII CATG 1 cut(s) 184
PctI GAATGC 1 cut(s) 185
SaqAI TTAA 1 cut(s) 202
Sau3AI GATC 1 cut(s) 39
SetI ASST 1 cut(s) 180
SgeI CNNG 6 cut(s) 42, 94, 134, 176, 187, 193
TaqI TCGA 1 cut(s) 189
Tru1I TTAA 1 cut(s) 202
Tru9I TTAA 1 cut(s) 202
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.