Rh2DG470700

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0006042
Physical Location & Seq
Forward (+)
68208229 .. 68210648
2420 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG470700.1

Sequence Viewer

Length: 402 bp
ATGGTGTTTGGAGAATTCTTGTACATCTCAACATTCGATAATTCGATCCGCATCGAACTTCTCCTCCTTCTCTCTCTGTTGTCACTGAAAGAATGGAATGGATCTACTTATGAAGATGGATCAAAAGAACATCGTTCCAGGTCCTCGATGAAGTTGTCATCGGCAAAAGCAACAACTGGATTTGGGATCATTTATACATCTTCAGAAGAAGAGGAGGATAATATACTCCAGAAAAAAACAATGACAAAATGCTCTCATCGTTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGGGAAATTCCTTTACCACAACATATGTGAAGGTTAAATTTAAAAATTGTAACTATATATATAGTTCTGTCCTGGAGTAG

Protein Analysis

133

Amino Acids

15.32

Weight (kDa)

6.82

Isoelectric Point (pI)

49.69

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 72 - 106 9.3e-10 RING-H2 zinc finger domain
zf-C3HC4 PF00097 75 - 106 1.2e-06 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4_2 PF13923 77 - 106 3.3e-07 Zinc finger, C3HC4 type (RING finger)
zf-RING_2 PF13639 80 - 106 1.8e-08 Ring finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 49
AclWI GGATC 4 cut(s) 40, 109, 127, 194
AcsI RAATTY 3 cut(s) 14, 328, 359
AcuI CTGAAG 1 cut(s) 186
AfaI GTAC 1 cut(s) 23
AjnI CCWGG 2 cut(s) 137, 393
AloI GAACNNNNNNTCC 2 cut(s) 48, 80
AlwI GGATC 4 cut(s) 40, 109, 127, 194
ApoI RAATTY 3 cut(s) 14, 328, 359
AspS9I GGNCC 1 cut(s) 141
AvaII GGWCC 1 cut(s) 141
BccI CCATC 2 cut(s) 110, 283
BciT130I CCWGG 2 cut(s) 139, 395
Bme1390I CCNGG 2 cut(s) 139, 395
Bme18I GGWCC 1 cut(s) 141
BmgT120I GGNCC 1 cut(s) 141
BmrFI CCNGG 2 cut(s) 139, 395
BmsI GCATC 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 212
BsaBI GATNNNNATC 1 cut(s) 50
BsaXI ACNNNNNCTCC 2 cut(s) 48, 78
Bse1I ACTGG 1 cut(s) 181
Bse8I GATNNNNATC 1 cut(s) 50
BseBI CCWGG 2 cut(s) 139, 395
BseGI GGATG 1 cut(s) 294
BseJI GATNNNNATC 1 cut(s) 50
BseNI ACTGG 1 cut(s) 181
BseRI GAGGAG 2 cut(s) 53, 227
Bsp1407I TGTACA 1 cut(s) 21
Bsp143I GATC 4 cut(s) 45, 101, 119, 186
BspACI CCGC 1 cut(s) 49
BspPI GGATC 4 cut(s) 40, 109, 127, 194
BsrGI TGTACA 1 cut(s) 21
BsrI ACTGG 1 cut(s) 181
BssMI GATC 4 cut(s) 45, 101, 119, 186
Bst2UI CCWGG 2 cut(s) 139, 395
Bst6I CTCTTC 1 cut(s) 204
BstAUI TGTACA 1 cut(s) 21
BstF5I GGATG 1 cut(s) 294
BstKTI GATC 4 cut(s) 48, 104, 122, 189
BstMBI GATC 4 cut(s) 45, 101, 119, 186
BstNI CCWGG 2 cut(s) 139, 395
BstSCI CCNGG 2 cut(s) 137, 393
BstX2I RGATCY 1 cut(s) 101
BstYI RGATCY 1 cut(s) 101
BtsCI GGATG 1 cut(s) 294
BtsIMutI CAGTG 1 cut(s) 83
Cfr13I GGNCC 1 cut(s) 141
Csp6I GTAC 1 cut(s) 22
CviQI GTAC 1 cut(s) 22
DpnI GATC 4 cut(s) 47, 103, 121, 188
DpnII GATC 4 cut(s) 45, 101, 119, 186
DraI TTTAAA 1 cut(s) 364
Eam1104I CTCTTC 1 cut(s) 204
EarI CTCTTC 1 cut(s) 204
Eco47I GGWCC 1 cut(s) 141
Eco57I CTGAAG 1 cut(s) 186
EcoO109I RGGNCCY 1 cut(s) 141
EcoRI GAATTC 1 cut(s) 14
EcoRII CCWGG 2 cut(s) 137, 393
FauNDI CATATG 1 cut(s) 346
FokI GGATG 1 cut(s) 301
GsuI CTGGAG 1 cut(s) 212
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 1 cut(s) 229
HpyAV CCTTC 2 cut(s) 77, 346
Kzo9I GATC 4 cut(s) 45, 101, 119, 186
LpnPI CCDG 6 cut(s) 124, 151, 162, 242, 324, 380
LweI GCATC 1 cut(s) 60
MaeIII GTNAC 2 cut(s) 81, 371
MalI GATC 4 cut(s) 47, 103, 121, 188
MboI GATC 4 cut(s) 45, 101, 119, 186
MboII GAAGA 4 cut(s) 125, 192, 218, 221
MflI RGATCY 1 cut(s) 101
MluCI AATT 5 cut(s) 14, 40, 328, 359, 367
MnlI CCTC 4 cut(s) 74, 154, 205, 208
MseI TTAA 2 cut(s) 357, 363
MspR9I CCNGG 2 cut(s) 139, 395
MvaI CCWGG 2 cut(s) 139, 395
NdeI CATATG 1 cut(s) 346
NdeII GATC 4 cut(s) 45, 101, 119, 186
NmuCI GTSAC 1 cut(s) 81
PfoI TCCNGGA 1 cut(s) 393
PpuMI RGGWCCY 1 cut(s) 141
Psp5II RGGWCCY 1 cut(s) 141
Psp6I CCWGG 2 cut(s) 137, 393
PspGI CCWGG 2 cut(s) 137, 393
PspPI GGNCC 1 cut(s) 141
PspPPI RGGWCCY 1 cut(s) 141
PsuI RGATCY 1 cut(s) 101
RsaI GTAC 1 cut(s) 23
RsaNI GTAC 1 cut(s) 22
SaqAI TTAA 2 cut(s) 357, 363
Sau3AI GATC 4 cut(s) 45, 101, 119, 186
Sau96I GGNCC 1 cut(s) 141
ScrFI CCNGG 2 cut(s) 139, 395
SetI ASST 2 cut(s) 143, 357
SfaNI GCATC 1 cut(s) 60
SgeI CNNG 9 cut(s) 31, 150, 151, 157, 189, 241, 281, 323, 334
SinI GGWCC 1 cut(s) 141
Sse9I AATT 5 cut(s) 14, 40, 328, 359, 367
SsiI CCGC 1 cut(s) 49
StyD4I CCNGG 2 cut(s) 137, 393
TaqI TCGA 4 cut(s) 36, 44, 54, 146
TasI AATT 5 cut(s) 14, 40, 328, 359, 367
TatI WGTACW 1 cut(s) 21
Tru1I TTAA 2 cut(s) 357, 363
Tru9I TTAA 2 cut(s) 357, 363
TscAI CASTG 1 cut(s) 90
TseFI GTSAC 1 cut(s) 81
Tsp45I GTSAC 1 cut(s) 81
TspDTI ATGAA 2 cut(s) 126, 164
TspRI CASTG 1 cut(s) 90
VpaK11BI GGWCC 1 cut(s) 141
XapI RAATTY 3 cut(s) 14, 328, 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.