Rh2BG461500

ubiquitin-protein transferase activity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
65294327 .. 65295175
849 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG461500.1

Sequence Viewer

Length: 255 bp
ATGAAGTTGTCATCGGCAAAAGCAACAACTGGATTTGGGATCATTTATACATCTTCAGAAGAAGAGGAGGATAATATACTCCAGAAAAAAACAATGACAAAATGCTCTCATCGTTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGGGAAATTCCTTTACCACAACATATGTGAAGGTTAAATTTAAAAATTGTAACTATATATATAGTTCTGTCCTGGAGTAG

Protein Analysis

84

Amino Acids

9.66

Weight (kDa)

8.27

Isoelectric Point (pI)

53.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 23 - 57 3.2e-10 RING-H2 zinc finger domain
zf-C3HC4 PF00097 26 - 57 4.7e-07 Zinc finger, C3HC4 type (RING finger)
zf-C3HC4_2 PF13923 28 - 57 1.4e-07 Zinc finger, C3HC4 type (RING finger)
zf-RING_2 PF13639 31 - 57 6.4e-09 Ring finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 47
AcsI RAATTY 2 cut(s) 181, 212
AcuI CTGAAG 1 cut(s) 39
AjnI CCWGG 1 cut(s) 246
AlwI GGATC 1 cut(s) 47
ApoI RAATTY 2 cut(s) 181, 212
BccI CCATC 1 cut(s) 136
BciT130I CCWGG 1 cut(s) 248
Bme1390I CCNGG 1 cut(s) 248
BmrFI CCNGG 1 cut(s) 248
BpmI CTGGAG 1 cut(s) 65
Bse1I ACTGG 1 cut(s) 34
BseBI CCWGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 147
BseNI ACTGG 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 80
Bsp143I GATC 1 cut(s) 39
BspPI GGATC 1 cut(s) 47
BsrI ACTGG 1 cut(s) 34
BssMI GATC 1 cut(s) 39
Bst2UI CCWGG 1 cut(s) 248
Bst6I CTCTTC 1 cut(s) 57
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 1 cut(s) 42
BstMBI GATC 1 cut(s) 39
BstNI CCWGG 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 246
BtsCI GGATG 1 cut(s) 147
DpnI GATC 1 cut(s) 41
DpnII GATC 1 cut(s) 39
DraI TTTAAA 1 cut(s) 217
Eam1104I CTCTTC 1 cut(s) 57
EarI CTCTTC 1 cut(s) 57
Eco57I CTGAAG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 246
FauNDI CATATG 1 cut(s) 199
FokI GGATG 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 82
HpyAV CCTTC 1 cut(s) 199
Kzo9I GATC 1 cut(s) 39
LpnPI CCDG 4 cut(s) 15, 95, 177, 233
MaeIII GTNAC 1 cut(s) 224
MalI GATC 1 cut(s) 41
MboI GATC 1 cut(s) 39
MboII GAAGA 3 cut(s) 45, 71, 74
MluCI AATT 3 cut(s) 181, 212, 220
MnlI CCTC 2 cut(s) 58, 61
MseI TTAA 2 cut(s) 210, 216
MspR9I CCNGG 1 cut(s) 248
MvaI CCWGG 1 cut(s) 248
NdeI CATATG 1 cut(s) 199
NdeII GATC 1 cut(s) 39
PfoI TCCNGGA 1 cut(s) 246
Psp6I CCWGG 1 cut(s) 246
PspGI CCWGG 1 cut(s) 246
SaqAI TTAA 2 cut(s) 210, 216
Sau3AI GATC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 248
SetI ASST 1 cut(s) 210
SgeI CNNG 5 cut(s) 42, 94, 134, 176, 187
Sse9I AATT 3 cut(s) 181, 212, 220
StyD4I CCNGG 1 cut(s) 246
TasI AATT 3 cut(s) 181, 212, 220
Tru1I TTAA 2 cut(s) 210, 216
Tru9I TTAA 2 cut(s) 210, 216
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 2 cut(s) 181, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.