Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0006042

Physical Location & Seq

Genomic Coordinates Forward (+)

63826009 .. 63828604

Gene Structure 2596 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ51590

Sequence Viewer

CDS Protein Promoter (2k)

Length: 204 bp

ATGAAGTTGTCATCGGCAAAAGCAACAACTGGATTTGGGATCATTTATACATCTTCAGAAGAAGAGGAGGATAATATACTCCAGAAAAAAACAATGACAAAATGCTCTCATCGTTATCATCTTGGTTGTATATATGAGTGGATGGAGAGAAGTGAAAGTTGTCCTGTTTGTAGCAAGGTCATGGCATTCGATGAAACGACTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000209 GO:0003674 GO:0003824 GO:0004842 GO:0006464 GO:0006508 GO:0006511 GO:0006807 GO:0008150 GO:0008152 GO:0009056 GO:0009057 GO:0009987 GO:0010498 GO:0016567 GO:0016740 GO:0019538 GO:0019787 GO:0019941 GO:0030163 GO:0032446 GO:0036211 GO:0043161 GO:0043170 GO:0043412 GO:0043632 GO:0044237 GO:0044238 GO:0044248 GO:0044257 GO:0044260 GO:0044265 GO:0044267 GO:0051603 GO:0061630 GO:0061659 GO:0070647 GO:0071704 GO:0140096 GO:1901564 GO:1901565 GO:1901575

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

zf-RING_2 zf-rbx1

Protein Analysis

67

Amino Acids

7.66

Weight (kDa)

5.58

Isoelectric Point (pI)

70.97

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
zf-rbx1	PF12678	22 - 57	1.7e-10	RING-H2 zinc finger domain
zf-C3HC4	PF00097	26 - 57	2.7e-07	Zinc finger, C3HC4 type (RING finger)
zf-C3HC4_2	PF13923	28 - 57	8e-08	Zinc finger, C3HC4 type (RING finger)
zf-RING_2	PF13639	30 - 57	3.7e-09	Ring finger domain
zf-ANAPC11	PF12861	32 - 64	7.3e-06	Anaphase-promoting complex subunit 11 RING-H2 finger

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006042)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G38895 AT5G38895 AT5G38895
fragaria_vesca	FvH4_6g46360 FvH4_6g46360
malus_domestica	MD09G1074400.v1.1 MD17G1065800.v1.1
prunus_persica	Prupe.3G248900_v2.0.a1 Prupe.3G248900_v2.0.a1 Prupe.3G248900_v2.0.a1
pyrus_communis	pycom09g00150 pycom17g06610
rosa_chinensis	RchiOBHm_Chr2g0146111 RchiOBHm_Chr2g0164901
rosa_laevigata	RLG00000021495
rosa_multiflora	Rmu_sc0006207.1_g000009
rosa_roxburghii	Rroxscaffold_2G00086230
rosa_rugosa	Rorug02G0511100 Rorug02G0511200 Rorug02G0511200
rosa_samantha	Rh2AG579300 Rh2BG461500 Rh2BG590300 Rh2CG561000 Rh2DG470700 Rh2DG600700
rosa_wichuraiana	Rw2G048080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	47
AcuI	CTGAAG	1 cut(s)	39
AlwI	GGATC	1 cut(s)	47
BccI	CCATC	1 cut(s)	136
BpmI	CTGGAG	1 cut(s)	65
Bse1I	ACTGG	1 cut(s)	34
BseGI	GGATG	1 cut(s)	147
BseNI	ACTGG	1 cut(s)	34
BseRI	GAGGAG	1 cut(s)	80
BsmI	GAATGC	1 cut(s)	185
Bsp143I	GATC	1 cut(s)	39
BspPI	GGATC	1 cut(s)	47
BsrI	ACTGG	1 cut(s)	34
BssMI	GATC	1 cut(s)	39
Bst6I	CTCTTC	1 cut(s)	57
BstF5I	GGATG	1 cut(s)	147
BstKTI	GATC	1 cut(s)	42
BstMBI	GATC	1 cut(s)	39
BtsCI	GGATG	1 cut(s)	147
CviAII	CATG	1 cut(s)	181
DpnI	GATC	1 cut(s)	41
DpnII	GATC	1 cut(s)	39
Eam1104I	CTCTTC	1 cut(s)	57
EarI	CTCTTC	1 cut(s)	57
Eco57I	CTGAAG	1 cut(s)	39
FaeI	CATG	1 cut(s)	184
FaiI	YATR	6 cut(s)	48, 77, 131, 133, 135, 182
FatI	CATG	1 cut(s)	180
FokI	GGATG	1 cut(s)	154
GsuI	CTGGAG	1 cut(s)	65
Hin1II	CATG	1 cut(s)	184
Hpy188I	TCNGA	1 cut(s)	58
Hpy188III	TCNNGA	1 cut(s)	82
Hsp92II	CATG	1 cut(s)	184
Kzo9I	GATC	1 cut(s)	39
LpnPI	CCDG	3 cut(s)	15, 95, 177
MalI	GATC	1 cut(s)	41
MboI	GATC	1 cut(s)	39
MboII	GAAGA	3 cut(s)	45, 71, 74
MnlI	CCTC	2 cut(s)	58, 61
MseI	TTAA	1 cut(s)	202
Mva1269I	GAATGC	1 cut(s)	185
NdeII	GATC	1 cut(s)	39
NlaIII	CATG	1 cut(s)	184
PctI	GAATGC	1 cut(s)	185
SaqAI	TTAA	1 cut(s)	202
Sau3AI	GATC	1 cut(s)	39
SetI	ASST	1 cut(s)	180
SgeI	CNNG	6 cut(s)	42, 94, 134, 176, 187, 193
TaqI	TCGA	1 cut(s)	189
Tru1I	TTAA	1 cut(s)	202
Tru9I	TTAA	1 cut(s)	202
TspDTI	ATGAA	1 cut(s)	17

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.