Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0008916

Physical Location & Seq

Genomic Coordinates Forward (+)

9220251 .. 9220676

Gene Structure 426 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 384 bp

ATGGTATCTTTAGTGATAACTCTGTGGAAATTTATTTGGAACTTGCAGCTTCCTCCCAAACTGAAGACATTCACATGGATTGTTTGTCATGATAAAATCTTGACAAATGTTCAAAGAGCCAAAAGGAATTTGACCAATGAAAACTCTTGTCCTTTATGCCATCAAGCTCCTGAGACTCTTGCTCCCCTATTTCGAGATTGCCCTGCTGTTCAAGTGATATGGAATTCTTTCAATATTCCATCTTGTGTGGATAATACTTCTCAGTTGAATTGGAATGGTTGGCTTATGGCTTATCTTCTGTGCAAGGTCAGTTTTAGCTACAAATTGCAATGGAATTCAATGTTTGTGTTCATTTGTTGGTATAACTGGAAATGGAGGAATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_3 zf-RVT

Protein Analysis

127

Amino Acids

15.17

Weight (kDa)

9.23

Isoelectric Point (pI)

47.02

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
zf-RVT	PF13966	7 - 74	6.9e-17	zinc-binding in reverse transcriptase

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008916)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G43940
fragaria_vesca	FvH4_6g25562
pyrus_communis	pycom04g06860 pycom08g15580
rosa_chinensis	RchiOBHm_Chr1g0321741 RchiOBHm_Chr4g0394881 RchiOBHm_Chr4g0426651 RchiOBHm_Chr6g0253621
rosa_laevigata	RLG00000020413
rosa_multiflora	Rmu_sc0003895.1_g000034 Rmu_sc0010958.1_g000004 Rmu_sc0011261.1_g000002 Rmu_ssc0000474.1_g000005
rosa_roxburghii	Rroxscaffold_1G00031210 Rroxscaffold_1G00048720 Rroxscaffold_2G00088920 Rroxscaffold_6G00409730
rosa_rugosa	Rorug02G0371000 Rorug07G0091500 Rorug07G0252000 Rorug07G0286400
rosa_wichuraiana	Rw5G037290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	4 cut(s)	29, 127, 223, 334
AcuI	CTGAAG	1 cut(s)	83
AgsI	TTSAA	5 cut(s)	113, 212, 232, 268, 339
AluBI	AGCT	3 cut(s)	49, 167, 318
AluI	AGCT	3 cut(s)	49, 167, 318
Alw26I	GTCTC	1 cut(s)	167
ApeKI	GCWGC	1 cut(s)	46
ApoI	RAATTY	4 cut(s)	29, 127, 223, 334
Asp700I	GAANNNNTTC	2 cut(s)	68, 227
BbsI	GAAGAC	1 cut(s)	71
BbvI	GCAGC	1 cut(s)	58
BccI	CCATC	2 cut(s)	168, 247
BcoDI	GTCTC	1 cut(s)	167
BisI	GCNGC	1 cut(s)	47
BlsI	GCNGC	1 cut(s)	48
BpiI	GAAGAC	1 cut(s)	71
BsaXI	ACNNNNNCTCC	2 cut(s)	166, 196
Bse1I	ACTGG	1 cut(s)	371
Bse3DI	GCAATG	1 cut(s)	335
BseMI	GCAATG	1 cut(s)	335
BseMII	CTCAG	2 cut(s)	162, 275
BseNI	ACTGG	1 cut(s)	371
BseXI	GCAGC	1 cut(s)	58
BsmAI	GTCTC	1 cut(s)	167
BspCNI	CTCAG	2 cut(s)	163, 274
BspHI	TCATGA	1 cut(s)	88
BsrDI	GCAATG	1 cut(s)	335
BsrI	ACTGG	1 cut(s)	371
BstDEI	CTNAG	2 cut(s)	171, 261
BstMAI	GTCTC	1 cut(s)	167
BstV1I	GCAGC	1 cut(s)	58
BstV2I	GAAGAC	1 cut(s)	71
CciI	TCATGA	1 cut(s)	88
CviAII	CATG	2 cut(s)	75, 89
CviJI	RGCY	6 cut(s)	49, 119, 167, 283, 290, 318
CviKI_1	RGCY	6 cut(s)	49, 119, 167, 283, 290, 318
DdeI	CTNAG	2 cut(s)	171, 261
Eco57I	CTGAAG	1 cut(s)	83
EcoRI	GAATTC	2 cut(s)	223, 334
FaeI	CATG	2 cut(s)	78, 92
FaiI	YATR	6 cut(s)	76, 90, 157, 220, 287, 363
FatI	CATG	2 cut(s)	74, 88
Fnu4HI	GCNGC	1 cut(s)	47
Fsp4HI	GCNGC	1 cut(s)	47
GluI	GCNGC	1 cut(s)	47
Hin1II	CATG	2 cut(s)	78, 92
HinfI	GANTC	1 cut(s)	175
Hpy188III	TCNNGA	4 cut(s)	89, 100, 170, 194
HpyCH4V	TGCA	3 cut(s)	46, 303, 328
HpyF3I	CTNAG	2 cut(s)	171, 261
Hsp92II	CATG	2 cut(s)	78, 92
LmnI	GCTCC	2 cut(s)	172, 187
LpnPI	CCDG	3 cut(s)	183, 216, 352
Lsp1109I	GCAGC	1 cut(s)	58
MboII	GAAGA	2 cut(s)	76, 287
MluCI	AATT	7 cut(s)	29, 127, 223, 268, 323, 334, 379
MlyI	GAGTC	1 cut(s)	169
MnlI	CCTC	2 cut(s)	63, 369
MroXI	GAANNNNTTC	2 cut(s)	68, 227
MslI	CAYNNNNRTG	1 cut(s)	73
NlaIII	CATG	2 cut(s)	78, 92
PagI	TCATGA	1 cut(s)	88
PdmI	GAANNNNTTC	2 cut(s)	68, 227
PkrI	GCNGC	1 cut(s)	48
PleI	GAGTC	1 cut(s)	169
PpsI	GAGTC	1 cut(s)	169
RseI	CAYNNNNRTG	1 cut(s)	73
SatI	GCNGC	1 cut(s)	47
SchI	GAGTC	1 cut(s)	169
SetI	ASST	4 cut(s)	51, 169, 309, 320
SmiMI	CAYNNNNRTG	1 cut(s)	73
Sse9I	AATT	7 cut(s)	29, 127, 223, 268, 323, 334, 379
SspI	AATATT	1 cut(s)	235
TaqI	TCGA	1 cut(s)	193
TasI	AATT	7 cut(s)	29, 127, 223, 268, 323, 334, 379
TseI	GCWGC	1 cut(s)	46
TspDTI	ATGAA	2 cut(s)	153, 340
XapI	RAATTY	4 cut(s)	29, 127, 223, 334
XmnI	GAANNNNTTC	2 cut(s)	68, 227

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.