RchiOBHm_Chr1g0327391

Heparan-alpha-glucosaminide

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
16195715 .. 16196044
330 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGATTACTCGCATTCTCTTTTCCATTGAAGTGATATATTGGATCCAGAAGCACATTTTTGTTGGGATTTGGCATTCAAGGAGAGTAGGCATTCTACTCTATGTAATCTTCGCAGAGATCTTGTTTTGGGGCATTGTCGCTGACATTTTGCATTGGTTGGGCATATATTGGAAGCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

7.2

Weight (kDa)

9.4

Isoelectric Point (pI)

41.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 37, 50
AgsI TTSAA 2 cut(s) 29, 78
AluBI AGCT 1 cut(s) 175
AluI AGCT 1 cut(s) 175
AlwI GGATC 2 cut(s) 37, 50
BamHI GGATCC 1 cut(s) 42
BglII AGATCT 1 cut(s) 117
BmiI GGNNCC 1 cut(s) 44
BsmI GAATGC 3 cut(s) 12, 73, 90
Bsp143I GATC 2 cut(s) 42, 117
BspLI GGNNCC 1 cut(s) 44
BspPI GGATC 2 cut(s) 37, 50
BssMI GATC 2 cut(s) 42, 117
BstKTI GATC 2 cut(s) 45, 120
BstMBI GATC 2 cut(s) 42, 117
BstX2I RGATCY 2 cut(s) 42, 117
BstYI RGATCY 2 cut(s) 42, 117
CviJI RGCY 1 cut(s) 175
CviKI_1 RGCY 1 cut(s) 175
DpnI GATC 2 cut(s) 44, 119
DpnII GATC 2 cut(s) 42, 117
FaiI YATR 4 cut(s) 37, 102, 164, 166
HindIII AAGCTT 1 cut(s) 173
Hpy188III TCNNGA 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 151
Kzo9I GATC 2 cut(s) 42, 117
LpnPI CCDG 1 cut(s) 59
MalI GATC 2 cut(s) 44, 119
MboI GATC 2 cut(s) 42, 117
MboII GAAGA 1 cut(s) 100
MflI RGATCY 2 cut(s) 42, 117
MseI TTAA 1 cut(s) 178
MslI CAYNNNNRTG 1 cut(s) 29
Mva1269I GAATGC 3 cut(s) 12, 73, 90
NdeII GATC 2 cut(s) 42, 117
NlaIV GGNNCC 1 cut(s) 44
PctI GAATGC 3 cut(s) 12, 73, 90
PspN4I GGNNCC 1 cut(s) 44
PsuI RGATCY 2 cut(s) 42, 117
RseI CAYNNNNRTG 1 cut(s) 29
SaqAI TTAA 1 cut(s) 178
Sau3AI GATC 2 cut(s) 42, 117
SetI ASST 1 cut(s) 177
SgeI CNNG 4 cut(s) 21, 58, 90, 133
SmiMI CAYNNNNRTG 1 cut(s) 29
Tru1I TTAA 1 cut(s) 178
Tru9I TTAA 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.