Rh3AG317900

Belongs to the glycosyltransferase 1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0006954
Physical Location & Seq
Forward (+)
43923178 .. 43924766
1589 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG317900.1

Sequence Viewer

Length: 333 bp
ATGACAACACAGTTTTTGAGCCCTACAAGGACAGCAAAGTGGATCTTCTTGGCCCAAAGTTGCCAATTTGGGGACTTGGCACTTGGTGTGTGGAAGCTTAACACATTGGGGTTGCTTCCTACACATGCATCCGACTGGTTTTCATCCTTACCCCCTGCTCAGGTAATACCTCCTGGAATGGAATTTCATCATATTATTCCACCTGCAGATGGTGATGCAGATCGGAAAGGGGAAAGAAATGATGATAGTAATGTTAATCCTGACCTGCCAATTTGGTCAAGAAATGATGATAGCACTGCTAATCCTGACCTGCCAATTTTGCCTTGGTATTGA

Protein Analysis

110

Amino Acids

12.27

Weight (kDa)

4.64

Isoelectric Point (pI)

41.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMC4 PF06417 12 - 50 8.3e-09 ER membrane protein complex subunit 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 211
Acc36I ACCTGC 3 cut(s) 211, 273, 318
AclWI GGATC 1 cut(s) 50
AcsI RAATTY 1 cut(s) 182
AdeI CACNNNGTG 1 cut(s) 86
AfiI CCNNNNNNNGG 3 cut(s) 70, 160, 209
AjnI CCWGG 1 cut(s) 172
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AlwI GGATC 1 cut(s) 50
AoxI GGCC 1 cut(s) 51
ApoI RAATTY 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 224
BanII GRGCYC 1 cut(s) 23
BccI CCATC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 204
BfuAI ACCTGC 3 cut(s) 211, 273, 318
Bme1390I CCNGG 1 cut(s) 174
BmgT120I GGNCC 1 cut(s) 52
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 2 cut(s) 137, 205
Bpu10I CCTNAGC 1 cut(s) 159
BsaBI GATNNNNATC 1 cut(s) 219
BsaJI CCNNGG 1 cut(s) 323
Bsc4I CCNNNNNNNGG 3 cut(s) 70, 160, 209
Bse1I ACTGG 1 cut(s) 140
Bse8I GATNNNNATC 1 cut(s) 219
BseBI CCWGG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 323
BseGI GGATG 2 cut(s) 128, 143
BseJI GATNNNNATC 1 cut(s) 219
BseLI CCNNNNNNNGG 3 cut(s) 70, 160, 209
BseMII CTCAG 1 cut(s) 173
BseNI ACTGG 1 cut(s) 140
BshFI GGCC 1 cut(s) 53
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 3 cut(s) 70, 160, 209
BsmFI GGGAC 1 cut(s) 86
BsnI GGCC 1 cut(s) 53
Bsp1286I GDGCHC 1 cut(s) 23
Bsp143I GATC 2 cut(s) 42, 220
BspANI GGCC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 172
BspMAI CTGCAG 1 cut(s) 208
BspMI ACCTGC 3 cut(s) 211, 273, 318
BspPI GGATC 1 cut(s) 50
BsrI ACTGG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 323
BssMI GATC 2 cut(s) 42, 220
BssT1I CCWWGG 1 cut(s) 323
Bst2UI CCWGG 1 cut(s) 174
Bst4CI ACNGT 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 2 cut(s) 128, 143
BstKTI GATC 2 cut(s) 45, 223
BstMBI GATC 2 cut(s) 42, 220
BstMWI GCNNNNNNNGC 1 cut(s) 319
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 204
BstX2I RGATCY 1 cut(s) 42
BstYI RGATCY 1 cut(s) 42
BsuRI GGCC 1 cut(s) 53
BtsCI GGATG 2 cut(s) 128, 143
BtsI GCAGTG 1 cut(s) 294
BtsIMutI CAGTG 1 cut(s) 294
BveI ACCTGC 3 cut(s) 211, 273, 318
Cfr13I GGNCC 1 cut(s) 52
CviAII CATG 1 cut(s) 125
CviJI RGCY 3 cut(s) 21, 53, 97
CviKI_1 RGCY 3 cut(s) 21, 53, 97
DdeI CTNAG 1 cut(s) 159
DpnI GATC 2 cut(s) 44, 222
DpnII GATC 2 cut(s) 42, 220
DraIII CACNNNGTG 1 cut(s) 86
Eco130I CCWWGG 1 cut(s) 323
Eco24I GRGCYC 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 323
EcoT22I ATGCAT 1 cut(s) 130
EcoT38I GRGCYC 1 cut(s) 23
ErhI CCWWGG 1 cut(s) 323
FaeI CATG 1 cut(s) 128
FaiI YATR 2 cut(s) 126, 192
FalI AAGNNNNNCTT 2 cut(s) 29, 61
FaqI GGGAC 1 cut(s) 86
FatI CATG 1 cut(s) 124
FokI GGATG 2 cut(s) 115, 130
FriOI GRGCYC 1 cut(s) 23
HaeIII GGCC 1 cut(s) 53
Hin1II CATG 1 cut(s) 128
HindIII AAGCTT 1 cut(s) 95
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 2 cut(s) 133, 225
Hpy188III TCNNGA 3 cut(s) 260, 279, 305
HpyCH4III ACNGT 1 cut(s) 12
HpyCH4V TGCA 3 cut(s) 128, 206, 218
HpyF10VI GCNNNNNNNGC 1 cut(s) 319
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 128
Kzo9I GATC 2 cut(s) 42, 220
LweI GCATC 2 cut(s) 137, 205
MalI GATC 2 cut(s) 44, 222
MboI GATC 2 cut(s) 42, 220
MboII GAAGA 1 cut(s) 37
MflI RGATCY 1 cut(s) 42
MhlI GDGCHC 1 cut(s) 23
MluCI AATT 4 cut(s) 65, 182, 270, 315
MmeI TCCRAC 1 cut(s) 156
MnlI CCTC 1 cut(s) 180
Mph1103I ATGCAT 1 cut(s) 130
MseI TTAA 2 cut(s) 99, 255
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 1 cut(s) 319
NdeII GATC 2 cut(s) 42, 220
NlaIII CATG 1 cut(s) 128
NsiI ATGCAT 1 cut(s) 130
NspI RCATGY 1 cut(s) 128
PaqCI CACCTGC 1 cut(s) 211
PfoI TCCNGGA 1 cut(s) 172
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspPI GGNCC 1 cut(s) 52
PstI CTGCAG 1 cut(s) 208
PsuI RGATCY 1 cut(s) 42
SaqAI TTAA 2 cut(s) 99, 255
Sau3AI GATC 2 cut(s) 42, 220
Sau96I GGNCC 1 cut(s) 52
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 23
SetI ASST 6 cut(s) 99, 165, 172, 205, 267, 312
SfaNI GCATC 2 cut(s) 137, 205
SfcI CTRYAG 1 cut(s) 204
Sse9I AATT 4 cut(s) 65, 182, 270, 315
StyD4I CCNGG 1 cut(s) 172
StyI CCWWGG 1 cut(s) 323
TaaI ACNGT 1 cut(s) 12
TasI AATT 4 cut(s) 65, 182, 270, 315
Tru1I TTAA 2 cut(s) 99, 255
Tru9I TTAA 2 cut(s) 99, 255
TscAI CASTG 1 cut(s) 301
TspDTI ATGAA 2 cut(s) 132, 176
TspRI CASTG 1 cut(s) 301
XapI RAATTY 1 cut(s) 182
XceI RCATGY 1 cut(s) 128
XcmI CCANNNNNNNNNTGG 1 cut(s) 321
Zsp2I ATGCAT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.