Rh6AG114600

ER membrane protein complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0006954
Physical Location & Seq
Reverse (-)
17282511 .. 17300421
17911 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG114600.1

Sequence Viewer

Length: 246 bp
ATGGCTTCATTTTCCAAATTTTTGAGCCCTACAAGGACAGCAAAGTGGATCTTCTTGGCCCAAAGTTGCCAATTTGGGGACTTGGCACTTGGTGTGTGGAAGCTTAACACATTGGGGTTGCTTCCTACACATGCATCCGACTGGGTTTCATCCTTACCCCCTGCTCAGGTACTGTTTGAATTTTCATCGCTTTATTTAATTATGCGTCAGATAATTACATGTCTGGATGTGTTGAACGTAGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1077

Protein Analysis

81

Amino Acids

9.02

Weight (kDa)

7.81

Isoelectric Point (pI)

38.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EMC4 PF06417 13 - 52 3.4e-09 ER membrane protein complex subunit 4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 56
AcsI RAATTY 2 cut(s) 17, 179
AdeI CACNNNGTG 1 cut(s) 92
AfaI GTAC 1 cut(s) 171
AfiI CCNNNNNNNGG 2 cut(s) 76, 166
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 2 cut(s) 179, 235
AluBI AGCT 2 cut(s) 103, 242
AluI AGCT 2 cut(s) 103, 242
AlwI GGATC 1 cut(s) 56
AlwNI CAGNNNCTG 1 cut(s) 172
AoxI GGCC 1 cut(s) 57
ApoI RAATTY 2 cut(s) 17, 179
AspS9I GGNCC 1 cut(s) 58
BanII GRGCYC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 58
BmrI ACTGGG 1 cut(s) 151
BmsI GCATC 1 cut(s) 143
BmuI ACTGGG 1 cut(s) 151
Bpu10I CCTNAGC 1 cut(s) 165
Bsc4I CCNNNNNNNGG 2 cut(s) 76, 166
Bse1I ACTGG 1 cut(s) 146
BseGI GGATG 3 cut(s) 134, 149, 232
BseLI CCNNNNNNNGG 2 cut(s) 76, 166
BseMII CTCAG 1 cut(s) 179
BseNI ACTGG 1 cut(s) 146
BshFI GGCC 1 cut(s) 59
BslFI GGGAC 1 cut(s) 92
BslI CCNNNNNNNGG 2 cut(s) 76, 166
BsmFI GGGAC 1 cut(s) 92
BsnI GGCC 1 cut(s) 59
Bsp1286I GDGCHC 1 cut(s) 29
Bsp143I GATC 1 cut(s) 48
BspANI GGCC 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 178
BspPI GGATC 1 cut(s) 56
BsrI ACTGG 1 cut(s) 146
BssMI GATC 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 174
BstDEI CTNAG 2 cut(s) 165, 243
BstF5I GGATG 3 cut(s) 134, 149, 232
BstKTI GATC 1 cut(s) 51
BstMBI GATC 1 cut(s) 48
BstNSI RCATGY 2 cut(s) 134, 222
BstX2I RGATCY 1 cut(s) 48
BstYI RGATCY 1 cut(s) 48
BsuRI GGCC 1 cut(s) 59
BtgZI GCGATG 1 cut(s) 171
BtsCI GGATG 3 cut(s) 134, 149, 232
CaiI CAGNNNCTG 1 cut(s) 172
Cfr13I GGNCC 1 cut(s) 58
CseI GACGC 1 cut(s) 194
Csp6I GTAC 1 cut(s) 170
CviAII CATG 2 cut(s) 131, 219
CviJI RGCY 5 cut(s) 5, 27, 59, 103, 242
CviKI_1 RGCY 5 cut(s) 5, 27, 59, 103, 242
CviQI GTAC 1 cut(s) 170
DdeI CTNAG 2 cut(s) 165, 243
DpnI GATC 1 cut(s) 50
DpnII GATC 1 cut(s) 48
DraIII CACNNNGTG 1 cut(s) 92
Eco24I GRGCYC 1 cut(s) 29
EcoT22I ATGCAT 1 cut(s) 136
EcoT38I GRGCYC 1 cut(s) 29
FaeI CATG 2 cut(s) 134, 222
FaiI YATR 3 cut(s) 132, 203, 220
FalI AAGNNNNNCTT 2 cut(s) 35, 67
FaqI GGGAC 1 cut(s) 92
FatI CATG 2 cut(s) 130, 218
FokI GGATG 3 cut(s) 121, 136, 239
FriOI GRGCYC 1 cut(s) 29
HaeIII GGCC 1 cut(s) 59
HgaI GACGC 1 cut(s) 194
Hin1II CATG 2 cut(s) 134, 222
HindIII AAGCTT 1 cut(s) 101
Hpy188I TCNGA 2 cut(s) 139, 210
Hpy188III TCNNGA 1 cut(s) 224
HpyCH4III ACNGT 1 cut(s) 174
HpyCH4IV ACGT 1 cut(s) 237
HpyCH4V TGCA 1 cut(s) 134
HpyF3I CTNAG 2 cut(s) 165, 243
HpySE526I ACGT 1 cut(s) 237
Hsp92II CATG 2 cut(s) 134, 222
Kzo9I GATC 1 cut(s) 48
LpnPI CCDG 4 cut(s) 127, 152, 174, 209
LweI GCATC 1 cut(s) 143
MaeII ACGT 1 cut(s) 237
MalI GATC 1 cut(s) 50
MboI GATC 1 cut(s) 48
MboII GAAGA 1 cut(s) 43
MflI RGATCY 1 cut(s) 48
MhlI GDGCHC 1 cut(s) 29
MluCI AATT 5 cut(s) 17, 71, 179, 198, 213
MmeI TCCRAC 1 cut(s) 162
Mph1103I ATGCAT 1 cut(s) 136
MseI TTAA 2 cut(s) 105, 197
NdeII GATC 1 cut(s) 48
NlaIII CATG 2 cut(s) 134, 222
NsiI ATGCAT 1 cut(s) 136
NspI RCATGY 2 cut(s) 134, 222
PciI ACATGT 1 cut(s) 218
PscI ACATGT 1 cut(s) 218
PspPI GGNCC 1 cut(s) 58
PstNI CAGNNNCTG 1 cut(s) 172
PsuI RGATCY 1 cut(s) 48
RsaI GTAC 1 cut(s) 171
RsaNI GTAC 1 cut(s) 170
SaqAI TTAA 2 cut(s) 105, 197
Sau3AI GATC 1 cut(s) 48
Sau96I GGNCC 1 cut(s) 58
SduI GDGCHC 1 cut(s) 29
SetI ASST 4 cut(s) 105, 171, 240, 244
SfaNI GCATC 1 cut(s) 143
Sse9I AATT 5 cut(s) 17, 71, 179, 198, 213
TaaI ACNGT 1 cut(s) 174
TaiI ACGT 1 cut(s) 240
TasI AATT 5 cut(s) 17, 71, 179, 198, 213
Tru1I TTAA 2 cut(s) 105, 197
Tru9I TTAA 2 cut(s) 105, 197
TspDTI ATGAA 2 cut(s) 138, 174
XapI RAATTY 2 cut(s) 17, 179
XceI RCATGY 2 cut(s) 134, 222
Zsp2I ATGCAT 1 cut(s) 136
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.