RchiOBHm_Chr1g0373201

Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
61562860 .. 61566502
3643 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 600 bp
ATGGCGTCTGGCACAGAGAGTGATGAAGCCTCTGACACTCCAGAAATTTACAAAGACCCAGATGATGGGAGGCAGCGATTCTTGCTTGAATTGGAGTTCATCCAATGTCTCGCAAATCCCACTTACATTCACTATTTGGCTCAAAATCGGTACTTTGAAGATGAAGCCTTCATTGGGTACTTGAAATATCTTCAGTATTGGCAGCGTCCTGATTACACCAAATTCATAATGTACCCTCATTGCTTGTTTTTTCTTGAGCAACTCCAAAATGCAAACTTTCGCAATGCAATGGCACATCCTGCCAACAAGGAATTGGCGCATAGGCAGCAATTCTACTTCTGGAAGAACTATAGGCACAACCGTTTGAAACACATATTACCTAGACCTCTTCCTGAACCCGAAGCTGCACCCCCCGTCTCTGCTCCGCCTCAGCAACCTGTGCCTGCTCTTCCACCTGTGCCAGCTGCAACCATTTCTGCTACAGCTACTGCTCCTGCCCTTCCCCCTATGCAGTATGCTAATGCCCCTGGATCTGCTCTTGCAAAGAATGATGCAAGGAATAGTGCGGTTGATCGAAGAAAGAGAAAGAAAGAAGGCTAA

Protein Analysis

199

Amino Acids

22.86

Weight (kDa)

8.45

Isoelectric Point (pI)

61.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Med31 PF05669 25 - 117 1.5e-34 SOH1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 65
AciI CCGC 2 cut(s) 425, 566
AclWI GGATC 1 cut(s) 538
AcsI RAATTY 2 cut(s) 45, 221
AcuI CTGAAG 1 cut(s) 176
AcyI GRCGYC 1 cut(s) 5
AfaI GTAC 3 cut(s) 152, 179, 233
AfiI CCNNNNNNNGG 2 cut(s) 65, 174
AgsI TTSAA 4 cut(s) 89, 158, 184, 367
AjnI CCWGG 1 cut(s) 526
AjuI GAANNNNNNNTTGG 2 cut(s) 156, 188
AluBI AGCT 3 cut(s) 404, 464, 485
AluI AGCT 3 cut(s) 404, 464, 485
Alw26I GTCTC 2 cut(s) 113, 421
AlwI GGATC 1 cut(s) 538
AlwNI CAGNNNCTG 1 cut(s) 488
ApeKI GCWGC 5 cut(s) 73, 202, 325, 404, 464
ApoI RAATTY 2 cut(s) 45, 221
AspLEI GCGC 1 cut(s) 319
BbvCI CCTCAGC 1 cut(s) 429
BbvI GCAGC 5 cut(s) 85, 214, 337, 391, 451
BccI CCATC 1 cut(s) 59
BciT130I CCWGG 1 cut(s) 528
BcoDI GTCTC 2 cut(s) 113, 421
BfaI CTAG 1 cut(s) 381
BfmI CTRYAG 2 cut(s) 349, 480
BisI GCNGC 5 cut(s) 74, 203, 326, 405, 465
BlsI GCNGC 5 cut(s) 75, 204, 327, 406, 466
Bme1390I CCNGG 1 cut(s) 528
BmrFI CCNGG 1 cut(s) 528
BmsI GCATC 1 cut(s) 541
BpmI CTGGAG 1 cut(s) 24
Bpu10I CCTNAGC 1 cut(s) 429
BpuEI CTTGAG 1 cut(s) 275
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 526
Bsc4I CCNNNNNNNGG 2 cut(s) 65, 174
Bse3DI GCAATG 3 cut(s) 238, 289, 294
BseBI CCWGG 1 cut(s) 528
BseDI CCNNGG 1 cut(s) 526
BseGI GGATG 2 cut(s) 99, 295
BseLI CCNNNNNNNGG 2 cut(s) 65, 174
BseMI GCAATG 3 cut(s) 238, 289, 294
BseMII CTCAG 1 cut(s) 443
BseXI GCAGC 5 cut(s) 85, 214, 337, 391, 451
BsgI GTGCAG 1 cut(s) 390
BslI CCNNNNNNNGG 2 cut(s) 65, 174
BsmAI GTCTC 2 cut(s) 113, 421
BsmBI CGTCTC 1 cut(s) 421
Bsp143I GATC 2 cut(s) 530, 571
BspACI CCGC 2 cut(s) 425, 566
BspCNI CTCAG 1 cut(s) 442
BspPI GGATC 1 cut(s) 538
BspQI GCTCTTC 1 cut(s) 453
BsrDI GCAATG 3 cut(s) 238, 289, 294
BssECI CCNNGG 1 cut(s) 526
BssMI GATC 2 cut(s) 530, 571
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 528
Bst4CI ACNGT 1 cut(s) 362
Bst6I CTCTTC 2 cut(s) 393, 453
BstACI GRCGYC 1 cut(s) 5
BstAPI GCANNNNNTGC 2 cut(s) 299, 439
BstC8I GCNNGC 2 cut(s) 444, 462
BstDEI CTNAG 1 cut(s) 429
BstF5I GGATG 2 cut(s) 99, 295
BstHHI GCGC 1 cut(s) 319
BstKTI GATC 2 cut(s) 533, 574
BstMAI GTCTC 2 cut(s) 113, 421
BstMBI GATC 2 cut(s) 530, 571
BstMWI GCNNNNNNNGC 4 cut(s) 82, 299, 325, 439
BstNI CCWGG 1 cut(s) 528
BstSCI CCNGG 1 cut(s) 526
BstSFI CTRYAG 2 cut(s) 349, 480
BstV1I GCAGC 5 cut(s) 85, 214, 337, 391, 451
BstX2I RGATCY 1 cut(s) 530
BstYI RGATCY 1 cut(s) 530
BtsCI GGATG 2 cut(s) 99, 295
Cac8I GCNNGC 2 cut(s) 444, 462
CaiI CAGNNNCTG 1 cut(s) 488
CfoI GCGC 1 cut(s) 319
CseI GACGC 1 cut(s) 194
Csp6I GTAC 3 cut(s) 151, 178, 232
CviJI RGCY 7 cut(s) 29, 140, 167, 404, 464, 485, 597
CviKI_1 RGCY 7 cut(s) 29, 140, 167, 404, 464, 485, 597
CviQI GTAC 3 cut(s) 151, 178, 232
DdeI CTNAG 1 cut(s) 429
DpnI GATC 2 cut(s) 532, 573
DpnII GATC 2 cut(s) 530, 571
Eam1104I CTCTTC 2 cut(s) 393, 453
EarI CTCTTC 2 cut(s) 393, 453
EciI GGCGGA 1 cut(s) 414
Eco57I CTGAAG 1 cut(s) 176
EcoRII CCWGG 1 cut(s) 526
Esp3I CGTCTC 1 cut(s) 421
FaiI YATR 6 cut(s) 227, 321, 351, 374, 509, 516
Fnu4HI GCNGC 5 cut(s) 74, 203, 326, 405, 465
FokI GGATG 2 cut(s) 86, 282
Fsp4HI GCNGC 5 cut(s) 74, 203, 326, 405, 465
FspBI CTAG 1 cut(s) 381
GlaI GCGC 1 cut(s) 318
GluI GCNGC 5 cut(s) 74, 203, 326, 405, 465
GsuI CTGGAG 1 cut(s) 24
HgaI GACGC 1 cut(s) 194
HhaI GCGC 1 cut(s) 319
Hin1I GRCGYC 1 cut(s) 5
Hin6I GCGC 1 cut(s) 317
HinP1I GCGC 1 cut(s) 317
HinfI GANTC 1 cut(s) 78
Hpy188I TCNGA 1 cut(s) 34
Hpy188III TCNNGA 5 cut(s) 41, 209, 254, 340, 392
HpyAV CCTTC 3 cut(s) 178, 509, 587
HpyCH4III ACNGT 1 cut(s) 362
HpyCH4V TGCA 7 cut(s) 272, 287, 407, 467, 511, 542, 554
HpyF10VI GCNNNNNNNGC 4 cut(s) 82, 299, 325, 439
HpyF3I CTNAG 1 cut(s) 429
Hsp92I GRCGYC 1 cut(s) 5
HspAI GCGC 1 cut(s) 317
Kzo9I GATC 2 cut(s) 530, 571
LguI GCTCTTC 1 cut(s) 453
LmnI GCTCC 2 cut(s) 427, 496
Lsp1109I GCAGC 5 cut(s) 85, 214, 337, 391, 451
LweI GCATC 1 cut(s) 541
MaeI CTAG 1 cut(s) 381
MalI GATC 2 cut(s) 532, 573
MboI GATC 2 cut(s) 530, 571
MboII GAAGA 6 cut(s) 170, 182, 355, 380, 440, 588
MflI RGATCY 1 cut(s) 530
MluCI AATT 5 cut(s) 45, 89, 221, 311, 329
MnlI CCTC 5 cut(s) 40, 63, 246, 396, 438
MspA1I CMGCKG 1 cut(s) 464
MspR9I CCNGG 1 cut(s) 528
MvaI CCWGG 1 cut(s) 528
MwoI GCNNNNNNNGC 4 cut(s) 82, 299, 325, 439
NdeII GATC 2 cut(s) 530, 571
PciSI GCTCTTC 1 cut(s) 453
PfeI GAWTC 1 cut(s) 78
PflMI CCANNNNNTGG 1 cut(s) 65
PkrI GCNGC 5 cut(s) 75, 204, 327, 406, 466
Psp6I CCWGG 1 cut(s) 526
PspGI CCWGG 1 cut(s) 526
PstNI CAGNNNCTG 1 cut(s) 488
PsuI RGATCY 1 cut(s) 530
PvuII CAGCTG 1 cut(s) 464
RsaI GTAC 3 cut(s) 152, 179, 233
RsaNI GTAC 3 cut(s) 151, 178, 232
SapI GCTCTTC 1 cut(s) 453
SatI GCNGC 5 cut(s) 74, 203, 326, 405, 465
Sau3AI GATC 2 cut(s) 530, 571
ScrFI CCNGG 1 cut(s) 528
SetI ASST 7 cut(s) 382, 388, 406, 439, 457, 466, 487
SfaNI GCATC 1 cut(s) 541
SfcI CTRYAG 2 cut(s) 349, 480
SmlI CTYRAG 1 cut(s) 254
SmoI CTYRAG 1 cut(s) 254
Sse9I AATT 5 cut(s) 45, 89, 221, 311, 329
SsiI CCGC 2 cut(s) 425, 566
SspMI CTAG 1 cut(s) 381
StyD4I CCNGG 1 cut(s) 526
TaaI ACNGT 1 cut(s) 362
TaqI TCGA 1 cut(s) 574
TasI AATT 5 cut(s) 45, 89, 221, 311, 329
TfiI GAWTC 1 cut(s) 78
TseI GCWGC 5 cut(s) 73, 202, 325, 404, 464
TspDTI ATGAA 5 cut(s) 39, 88, 160, 177, 214
Van91I CCANNNNNTGG 1 cut(s) 65
XapI RAATTY 2 cut(s) 45, 221
XcmI CCANNNNNNNNNTGG 1 cut(s) 310
XspI CTAG 1 cut(s) 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.