RchiOBHm_Chr2g0091761

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
5466160 .. 5468096
1937 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46693

Sequence Viewer

Length: 171 bp
ATGGGTCTGAGTGCTCGGCTGGGGTTTGGGGGCAAACTGAAAAACTGGACGCCATGGGTGATCAAAAGGCTTCCTGATGACTATCGGGTTGGGAAATCTCAATCAACTAAAGCTGCAAAGTTCAATTTCGTGGGCAATTTCTTCATCTGCAGATTAAGAAGCTTATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.44

Weight (kDa)

10.74

Isoelectric Point (pI)

15.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 50
AgsI TTSAA 1 cut(s) 124
AluBI AGCT 2 cut(s) 113, 162
AluI AGCT 2 cut(s) 113, 162
Alw21I GWGCWC 1 cut(s) 16
ApeKI GCWGC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 16
BbvI GCAGC 1 cut(s) 100
BclI TGATCA 1 cut(s) 60
BfmI CTRYAG 1 cut(s) 148
BisI GCNGC 1 cut(s) 114
BlsI GCNGC 1 cut(s) 115
BsaBI GATNNNNATC 1 cut(s) 81
BsaHI GRCGYC 1 cut(s) 50
BsaJI CCNNGG 1 cut(s) 53
Bse1I ACTGG 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 53
BseJI GATNNNNATC 1 cut(s) 81
BseNI ACTGG 1 cut(s) 50
BseXI GCAGC 1 cut(s) 100
BseYI CCCAGC 1 cut(s) 19
BsiHKAI GWGCWC 1 cut(s) 16
Bsp1286I GDGCHC 1 cut(s) 16
Bsp143I GATC 1 cut(s) 60
Bsp19I CCATGG 1 cut(s) 53
BspMAI CTGCAG 1 cut(s) 152
BsrI ACTGG 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 1 cut(s) 60
BssNI GRCGYC 1 cut(s) 50
BssT1I CCWWGG 1 cut(s) 53
BstACI GRCGYC 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 8
BstDSI CCRYGG 1 cut(s) 53
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstSFI CTRYAG 1 cut(s) 148
BstV1I GCAGC 1 cut(s) 100
BtgI CCRYGG 1 cut(s) 53
CseI GACGC 1 cut(s) 58
CviAII CATG 1 cut(s) 54
CviJI RGCY 4 cut(s) 19, 70, 113, 162
CviKI_1 RGCY 4 cut(s) 19, 70, 113, 162
DdeI CTNAG 1 cut(s) 8
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
Eco130I CCWWGG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 57
FaiI YATR 2 cut(s) 55, 166
FatI CATG 1 cut(s) 53
FbaI TGATCA 1 cut(s) 60
Fnu4HI GCNGC 1 cut(s) 114
Fsp4HI GCNGC 1 cut(s) 114
GluI GCNGC 1 cut(s) 114
GsaI CCCAGC 1 cut(s) 23
HgaI GACGC 1 cut(s) 58
Hin1I GRCGYC 1 cut(s) 50
Hin1II CATG 1 cut(s) 57
HindIII AAGCTT 1 cut(s) 160
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 1 cut(s) 9
Hpy188III TCNNGA 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 116, 150
HpyF3I CTNAG 1 cut(s) 8
Hsp92I GRCGYC 1 cut(s) 50
Hsp92II CATG 1 cut(s) 57
Ksp22I TGATCA 1 cut(s) 60
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 3 cut(s) 5, 31, 87
Lsp1109I GCAGC 1 cut(s) 100
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 1 cut(s) 133
MhlI GDGCHC 1 cut(s) 16
MluCI AATT 2 cut(s) 124, 136
MseI TTAA 1 cut(s) 155
NcoI CCATGG 1 cut(s) 53
NdeII GATC 1 cut(s) 60
NlaIII CATG 1 cut(s) 57
PkrI GCNGC 1 cut(s) 115
PspFI CCCAGC 1 cut(s) 19
PstI CTGCAG 1 cut(s) 152
SaqAI TTAA 1 cut(s) 155
SatI GCNGC 1 cut(s) 114
Sau3AI GATC 1 cut(s) 60
SduI GDGCHC 1 cut(s) 16
SetI ASST 2 cut(s) 115, 164
SfcI CTRYAG 1 cut(s) 148
SgeI CNNG 7 cut(s) 27, 32, 58, 66, 86, 98, 142
Sse9I AATT 2 cut(s) 124, 136
StyI CCWWGG 1 cut(s) 53
TasI AATT 2 cut(s) 124, 136
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TseI GCWGC 1 cut(s) 113
TspDTI ATGAA 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.