RchiOBHm_Chr2g0101441

Huntingtin-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
13085162 .. 13085335
174 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ47604

Sequence Viewer

Length: 174 bp
ATGGCTTCCATTGTTGCCACCTCAAAAGCCGATTTGGAAGCTATGAGAAAGAGGGAGAAAGAATTGGGTACTGTGAAGATCAATCCACGCGATGTTGAGATAATTGCCATCAATATGTTGCTGGGTTTGAATTGGAATAGTGAGGCAGGAAGTGAGTTTTTAAGGAAATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.37

Weight (kDa)

8.14

Isoelectric Point (pI)

20.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 90
AfaI GTAC 1 cut(s) 70
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
BccI CCATC 1 cut(s) 116
BseYI CCCAGC 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 90
Bsp143I GATC 1 cut(s) 78
BspFNI CGCG 1 cut(s) 90
BssMI GATC 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 73
BstFNI CGCG 1 cut(s) 90
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstUI CGCG 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 105
Csp6I GTAC 1 cut(s) 69
CviJI RGCY 3 cut(s) 5, 29, 41
CviKI_1 RGCY 3 cut(s) 5, 29, 41
CviQI GTAC 1 cut(s) 69
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
FaiI YATR 2 cut(s) 44, 116
GsaI CCCAGC 1 cut(s) 125
HpyCH4III ACNGT 1 cut(s) 73
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 2 cut(s) 107, 132
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 1 cut(s) 88
MluCI AATT 4 cut(s) 62, 102, 130, 167
MnlI CCTC 3 cut(s) 31, 45, 136
MseI TTAA 1 cut(s) 161
MslI CAYNNNNRTG 1 cut(s) 113
MvnI CGCG 1 cut(s) 90
NdeII GATC 1 cut(s) 78
PspFI CCCAGC 1 cut(s) 121
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 161
Sau3AI GATC 1 cut(s) 78
SetI ASST 2 cut(s) 23, 43
SgeI CNNG 4 cut(s) 99, 101, 134, 159
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 4 cut(s) 62, 102, 130, 167
TaaI ACNGT 1 cut(s) 73
TasI AATT 4 cut(s) 62, 102, 130, 167
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.