Rh7AG053400

Huntingtin-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
Physical Location & Seq
Reverse (-)
3695257 .. 3697949
2693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG053400.1

Sequence Viewer

Length: 222 bp
ATGGCTTCCATTGCTGCCACCTTAGAAGTCGATTTGGAAGCTATGAGAAAGAGGGAGAAAGAATTGGGTACTGTGAAGATCAATCCATGCGATGTTGAGATAATTGCCATCAATATGTTGCTGGGTTTTAATTGGAACAGTGAGGCAGGAACTAGGGTTTCCTCTCATCGCGATCCATCTCCTTCGTCACTGTTCAAGTGGTTATATTATCATAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.28

Weight (kDa)

6.05

Isoelectric Point (pI)

38.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 171
AclWI GGATC 1 cut(s) 167
AfaI GTAC 1 cut(s) 70
AgsI TTSAA 1 cut(s) 196
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AlwI GGATC 1 cut(s) 167
ApeKI GCWGC 1 cut(s) 14
BccI CCATC 2 cut(s) 116, 184
BfaI CTAG 1 cut(s) 153
BisI GCNGC 1 cut(s) 15
BlsI GCNGC 1 cut(s) 16
Bse3DI GCAATG 1 cut(s) 9
BseMI GCAATG 1 cut(s) 9
BseYI CCCAGC 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 171
Bsp143I GATC 2 cut(s) 78, 172
Bsp68I TCGCGA 1 cut(s) 171
BspFNI CGCG 1 cut(s) 171
BspPI GGATC 1 cut(s) 167
BsrDI GCAATG 1 cut(s) 9
BssMI GATC 2 cut(s) 78, 172
Bst4CI ACNGT 3 cut(s) 73, 140, 192
BstDEI CTNAG 1 cut(s) 22
BstFNI CGCG 1 cut(s) 171
BstKTI GATC 2 cut(s) 81, 175
BstMBI GATC 2 cut(s) 78, 172
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstUI CGCG 1 cut(s) 171
BtgZI GCGATG 2 cut(s) 105, 152
BtsIMutI CAGTG 2 cut(s) 145, 188
BtuMI TCGCGA 1 cut(s) 171
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 87
CviJI RGCY 2 cut(s) 5, 41
CviKI_1 RGCY 2 cut(s) 5, 41
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 1 cut(s) 22
DpnI GATC 2 cut(s) 80, 174
DpnII GATC 2 cut(s) 78, 172
FaeI CATG 1 cut(s) 90
FaiI YATR 5 cut(s) 44, 88, 116, 205, 213
FatI CATG 1 cut(s) 86
Fnu4HI GCNGC 1 cut(s) 15
Fsp4HI GCNGC 1 cut(s) 15
FspBI CTAG 1 cut(s) 153
GluI GCNGC 1 cut(s) 15
GsaI CCCAGC 1 cut(s) 125
Hin1II CATG 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 170
HpyAV CCTTC 1 cut(s) 192
HpyCH4III ACNGT 3 cut(s) 73, 140, 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 22
Hsp92II CATG 1 cut(s) 90
Kzo9I GATC 2 cut(s) 78, 172
LpnPI CCDG 2 cut(s) 107, 132
MaeI CTAG 1 cut(s) 153
MaeIII GTNAC 1 cut(s) 186
MalI GATC 2 cut(s) 80, 174
MboI GATC 2 cut(s) 78, 172
MboII GAAGA 1 cut(s) 88
MluCI AATT 4 cut(s) 62, 102, 130, 217
MnlI CCTC 3 cut(s) 45, 136, 172
MseI TTAA 2 cut(s) 129, 220
MslI CAYNNNNRTG 1 cut(s) 113
MvnI CGCG 1 cut(s) 171
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 2 cut(s) 78, 172
NlaIII CATG 1 cut(s) 90
NmuCI GTSAC 1 cut(s) 186
NruI TCGCGA 1 cut(s) 171
PkrI GCNGC 1 cut(s) 16
PspFI CCCAGC 1 cut(s) 121
RruI TCGCGA 1 cut(s) 171
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 2 cut(s) 129, 220
SatI GCNGC 1 cut(s) 15
Sau3AI GATC 2 cut(s) 78, 172
SetI ASST 2 cut(s) 23, 43
SgeI CNNG 6 cut(s) 99, 134, 159, 165, 182, 208
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 4 cut(s) 62, 102, 130, 217
SspMI CTAG 1 cut(s) 153
TaaI ACNGT 3 cut(s) 73, 140, 192
TaqI TCGA 1 cut(s) 30
TasI AATT 4 cut(s) 62, 102, 130, 217
Tru1I TTAA 2 cut(s) 129, 220
Tru9I TTAA 2 cut(s) 129, 220
TscAI CASTG 2 cut(s) 145, 195
TseFI GTSAC 1 cut(s) 186
TseI GCWGC 1 cut(s) 14
Tsp45I GTSAC 1 cut(s) 186
TspRI CASTG 2 cut(s) 145, 195
XspI CTAG 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.