Rh2CG152900

Huntingtin-interacting protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
13317486 .. 13317792
307 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG152900.1

Sequence Viewer

Length: 204 bp
ATGGCTTCCATTGTTGCCACCTCAAAAGCCGATTTGGAAGCTATGAGAAAGAGGGAGAAAGAATTGGGTACTGTGAAGATCAATCCACGCGATGTTGAGATAATTGCCATCAATATGTTGCTGGGTTTGAATTGGAATAGTGAGGCAGGAACTTCCACATGTCGTGTAATTATGTTGGTGCAAATTGGATTGCAGTTTCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.39

Weight (kDa)

7.92

Isoelectric Point (pI)

19.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 90
AfaI GTAC 1 cut(s) 70
AflIII ACRYGT 1 cut(s) 158
AgsI TTSAA 1 cut(s) 130
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
BccI CCATC 1 cut(s) 116
BseYI CCCAGC 1 cut(s) 121
Bsh1236I CGCG 1 cut(s) 90
Bsp143I GATC 1 cut(s) 78
BspFNI CGCG 1 cut(s) 90
BssMI GATC 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 73
BstFNI CGCG 1 cut(s) 90
BstKTI GATC 1 cut(s) 81
BstMBI GATC 1 cut(s) 78
BstNSI RCATGY 1 cut(s) 162
BstUI CGCG 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 105
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 159
CviJI RGCY 3 cut(s) 5, 29, 41
CviKI_1 RGCY 3 cut(s) 5, 29, 41
CviQI GTAC 1 cut(s) 69
DpnI GATC 1 cut(s) 80
DpnII GATC 1 cut(s) 78
FaeI CATG 1 cut(s) 162
FaiI YATR 4 cut(s) 44, 116, 160, 173
FatI CATG 1 cut(s) 158
GsaI CCCAGC 1 cut(s) 125
Hin1II CATG 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 181, 193
Hsp92II CATG 1 cut(s) 162
Kzo9I GATC 1 cut(s) 78
LpnPI CCDG 2 cut(s) 107, 132
MalI GATC 1 cut(s) 80
MboI GATC 1 cut(s) 78
MboII GAAGA 1 cut(s) 88
MluCI AATT 5 cut(s) 62, 102, 130, 168, 183
MnlI CCTC 3 cut(s) 31, 45, 136
MseI TTAA 1 cut(s) 202
MslI CAYNNNNRTG 1 cut(s) 113
MvnI CGCG 1 cut(s) 90
NdeII GATC 1 cut(s) 78
NlaIII CATG 1 cut(s) 162
NspI RCATGY 1 cut(s) 162
PciI ACATGT 1 cut(s) 158
PscI ACATGT 1 cut(s) 158
PspFI CCCAGC 1 cut(s) 121
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 202
Sau3AI GATC 1 cut(s) 78
SetI ASST 2 cut(s) 23, 43
SgeI CNNG 6 cut(s) 99, 101, 134, 159, 171, 176
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 5 cut(s) 62, 102, 130, 168, 183
TaaI ACNGT 1 cut(s) 73
TasI AATT 5 cut(s) 62, 102, 130, 168, 183
Tru1I TTAA 1 cut(s) 202
Tru9I TTAA 1 cut(s) 202
XceI RCATGY 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.